Incidental Mutation 'R1515:Zbtb48'
ID168213
Institutional Source Beutler Lab
Gene Symbol Zbtb48
Ensembl Gene ENSMUSG00000028952
Gene Namezinc finger and BTB domain containing 48
Synonyms0610011D15Rik, Hkr3
MMRRC Submission 039562-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1515 (G1)
Quality Score161
Status Not validated
Chromosome4
Chromosomal Location152019774-152027671 bp(-) (GRCm38)
Type of Mutationunclassified (2521 bp from exon)
DNA Base Change (assembly) A to G at 152020201 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000095380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066715] [ENSMUST00000097773] [ENSMUST00000155389] [ENSMUST00000156748]
Predicted Effect probably damaging
Transcript: ENSMUST00000066715
AA Change: F580L

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000067521
Gene: ENSMUSG00000028952
AA Change: F580L

DomainStartEndE-ValueType
BTB 26 119 1.35e-21 SMART
ZnF_C2H2 284 306 1.64e-1 SMART
ZnF_C2H2 312 332 2.06e1 SMART
ZnF_C2H2 343 365 5.99e-4 SMART
ZnF_C2H2 371 394 9.58e-3 SMART
ZnF_C2H2 400 423 2.49e-1 SMART
ZnF_C2H2 429 452 2.57e-3 SMART
ZnF_C2H2 458 480 9.73e-4 SMART
ZnF_C2H2 486 508 3.21e-4 SMART
ZnF_C2H2 514 537 1.67e-2 SMART
ZnF_C2H2 543 565 1.95e-3 SMART
ZnF_C2H2 571 593 5.67e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000097773
SMART Domains Protein: ENSMUSP00000095380
Gene: ENSMUSG00000073700

DomainStartEndE-ValueType
BTB 35 133 2.4e-27 SMART
BACK 138 239 3.93e-27 SMART
Kelch 287 334 1.08e0 SMART
Kelch 336 382 1.3e-7 SMART
Kelch 383 422 5.88e-1 SMART
Kelch 464 512 2.97e-1 SMART
Kelch 513 560 6.57e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147895
Predicted Effect probably benign
Transcript: ENSMUST00000155389
SMART Domains Protein: ENSMUSP00000114726
Gene: ENSMUSG00000028952

DomainStartEndE-ValueType
BTB 26 119 1.35e-21 SMART
ZnF_C2H2 284 306 1.64e-1 SMART
ZnF_C2H2 312 332 2.06e1 SMART
ZnF_C2H2 343 365 5.99e-4 SMART
ZnF_C2H2 371 394 9.58e-3 SMART
low complexity region 403 418 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155441
Predicted Effect probably benign
Transcript: ENSMUST00000156748
SMART Domains Protein: ENSMUSP00000117079
Gene: ENSMUSG00000028952

DomainStartEndE-ValueType
ZnF_C2H2 80 102 1.64e-1 SMART
ZnF_C2H2 108 128 2.06e1 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt2 A G 7: 27,637,158 T401A probably damaging Het
Arhgap32 G T 9: 32,116,202 V23L probably benign Het
Atmin T A 8: 116,954,840 C193S possibly damaging Het
Atp13a5 C T 16: 29,333,974 V225I probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
BC024139 A G 15: 76,124,326 V350A possibly damaging Het
Birc6 G T 17: 74,528,636 E29* probably null Het
Bnc2 T C 4: 84,414,326 N104S probably null Het
C030048H21Rik T C 2: 26,257,503 probably null Het
Cd320 G T 17: 33,847,639 C117F probably damaging Het
Cdkal1 A G 13: 29,326,150 S542P probably damaging Het
Crocc T C 4: 141,019,737 T1587A probably benign Het
Defb41 T C 1: 18,260,593 probably null Het
Dmtf1 A G 5: 9,140,384 probably null Het
Dnhd1 A G 7: 105,704,148 N2836S probably benign Het
Dpp8 G A 9: 65,078,748 S840N probably benign Het
Dsc2 A G 18: 20,034,701 F111L probably damaging Het
Dsc2 T A 18: 20,045,565 I261F probably benign Het
Ece1 T C 4: 137,951,508 V509A probably benign Het
Ecm2 T C 13: 49,518,332 M103T possibly damaging Het
Emsy T C 7: 98,590,856 H1064R probably damaging Het
Engase T C 11: 118,487,140 V252A possibly damaging Het
F13b A G 1: 139,510,965 Y369C probably damaging Het
Flii T C 11: 60,721,606 probably null Het
Fzd10 T A 5: 128,602,559 F448I probably damaging Het
Gpr35 T G 1: 92,983,048 F161V probably damaging Het
Gprin2 T C 14: 34,195,273 D180G possibly damaging Het
Grik3 A G 4: 125,670,728 N501S probably benign Het
Hells A G 19: 38,967,765 K802E probably damaging Het
Il1r1 T A 1: 40,293,349 C96* probably null Het
Kcnk16 T A 14: 20,265,277 I73F probably damaging Het
Kcnq5 A G 1: 21,402,681 S652P probably benign Het
Lamc3 A G 2: 31,940,751 D1500G probably damaging Het
Macf1 A G 4: 123,378,480 F6468L probably damaging Het
Mgrn1 T A 16: 4,915,780 F198I probably benign Het
Mmp3 A G 9: 7,451,232 T323A probably benign Het
N4bp2 A G 5: 65,790,498 Y157C probably benign Het
Nfkbid C A 7: 30,425,356 H190Q probably benign Het
Olfr1474 T C 19: 13,471,680 S237P probably damaging Het
Olfr512 T C 7: 108,713,941 V184A possibly damaging Het
Olfr790 T C 10: 129,501,591 S236P probably damaging Het
Osgin2 C T 4: 15,998,380 G414D probably benign Het
Pkd1 G A 17: 24,594,853 R4097H probably benign Het
Pnkd T A 1: 74,349,809 L213Q probably null Het
Ppfibp1 A G 6: 147,027,432 H850R probably benign Het
Ppp6r1 T C 7: 4,643,258 D148G probably damaging Het
Ptprt A T 2: 162,238,034 S282T probably damaging Het
Sgsm3 T C 15: 81,010,256 V536A probably benign Het
Slc22a23 T A 13: 34,203,964 Q383L probably benign Het
Snx29 T C 16: 11,399,837 probably null Het
Tmem229b-ps T A 10: 53,475,446 noncoding transcript Het
Tmod4 A T 3: 95,128,679 Y317F possibly damaging Het
Trim13 T C 14: 61,605,659 M375T probably benign Het
Txndc11 A G 16: 11,075,062 S935P probably damaging Het
Umod T C 7: 119,465,497 N592D probably benign Het
Vmn2r118 A G 17: 55,610,643 Y290H probably benign Het
Vps26b A G 9: 27,012,745 M234T probably damaging Het
Zfc3h1 T A 10: 115,416,742 F1320Y probably benign Het
Zfp784 A T 7: 5,036,040 probably benign Het
Other mutations in Zbtb48
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Zbtb48 APN 4 152021394 missense probably damaging 0.99
IGL02709:Zbtb48 APN 4 152021394 missense probably damaging 0.99
Etna UTSW 4 152021607 missense probably damaging 0.98
I0000:Zbtb48 UTSW 4 152019858 missense probably benign 0.34
R1844:Zbtb48 UTSW 4 152026498 missense probably benign
R2383:Zbtb48 UTSW 4 152026950 missense probably damaging 0.96
R3618:Zbtb48 UTSW 4 152026027 splice site probably null
R3619:Zbtb48 UTSW 4 152026027 splice site probably null
R5427:Zbtb48 UTSW 4 152020651 missense probably damaging 1.00
R5696:Zbtb48 UTSW 4 152020610 missense probably damaging 0.99
R6155:Zbtb48 UTSW 4 152022038 unclassified probably null
R6157:Zbtb48 UTSW 4 152021607 missense probably damaging 0.98
R6551:Zbtb48 UTSW 4 152022221 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGGGACTCCACAATGACCTCAG -3'
(R):5'- CATGCTCCTCAGAACCTTCAGCAG -3'

Sequencing Primer
(F):5'- TGACCTCAGCAGAGCCC -3'
(R):5'- AGCTTCTGTGACAGCGTG -3'
Posted On2014-04-13