Incidental Mutation 'R1515:Akt2'
ID168220
Institutional Source Beutler Lab
Gene Symbol Akt2
Ensembl Gene ENSMUSG00000004056
Gene Namethymoma viral proto-oncogene 2
SynonymsPKBbeta, PKB, 2410016A19Rik
MMRRC Submission 039562-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.881) question?
Stock #R1515 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location27591552-27640826 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27637158 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 401 (T401A)
Ref Sequence ENSEMBL: ENSMUSP00000083081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051356] [ENSMUST00000085917] [ENSMUST00000108342] [ENSMUST00000108343] [ENSMUST00000108344] [ENSMUST00000136962] [ENSMUST00000167435]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051356
AA Change: T444A

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000052103
Gene: ENSMUSG00000004056
AA Change: T444A

DomainStartEndE-ValueType
PH 6 110 3.05e-18 SMART
S_TKc 152 409 1.23e-105 SMART
S_TK_X 410 477 1.16e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000085917
AA Change: T401A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000083081
Gene: ENSMUSG00000004056
AA Change: T401A

DomainStartEndE-ValueType
PH 6 110 3.05e-18 SMART
Pfam:Pkinase 152 279 4.4e-32 PFAM
Pfam:Pkinase_Tyr 152 279 7.7e-15 PFAM
Pfam:Pkinase_Tyr 276 351 7e-6 PFAM
Pfam:Pkinase 277 366 1.3e-16 PFAM
S_TK_X 367 434 1.16e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108342
SMART Domains Protein: ENSMUSP00000103979
Gene: ENSMUSG00000004056

DomainStartEndE-ValueType
PH 6 110 3.05e-18 SMART
Pfam:Pkinase 142 222 1.2e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108343
AA Change: T444A

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103980
Gene: ENSMUSG00000004056
AA Change: T444A

DomainStartEndE-ValueType
PH 6 110 3.05e-18 SMART
S_TKc 152 409 1.23e-105 SMART
S_TK_X 410 477 1.16e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108344
AA Change: T444A

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103981
Gene: ENSMUSG00000004056
AA Change: T444A

DomainStartEndE-ValueType
PH 6 110 3.05e-18 SMART
S_TKc 152 409 1.23e-105 SMART
S_TK_X 410 477 1.16e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136962
SMART Domains Protein: ENSMUSP00000117682
Gene: ENSMUSG00000004056

DomainStartEndE-ValueType
PH 6 110 3.05e-18 SMART
Pfam:Pkinase 152 229 9.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136981
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143347
Predicted Effect possibly damaging
Transcript: ENSMUST00000167435
AA Change: T444A

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132141
Gene: ENSMUSG00000004056
AA Change: T444A

DomainStartEndE-ValueType
PH 6 110 3.05e-18 SMART
S_TKc 152 409 1.23e-105 SMART
S_TK_X 410 477 1.16e-14 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a putative oncogene encoding a protein belonging to a subfamily of serine/threonine kinases containing SH2-like (Src homology 2-like) domains. The gene was shown to be amplified and overexpressed in 2 of 8 ovarian carcinoma cell lines and 2 of 15 primary ovarian tumors. Overexpression contributes to the malignant phenotype of a subset of human ductal pancreatic cancers. The encoded protein is a general protein kinase capable of phophorylating several known proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit insulin resistance and elevated plasma triglycerides. In males, the insulin resistance may progress to overt diabetes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap32 G T 9: 32,116,202 V23L probably benign Het
Atmin T A 8: 116,954,840 C193S possibly damaging Het
Atp13a5 C T 16: 29,333,974 V225I probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
BC024139 A G 15: 76,124,326 V350A possibly damaging Het
Birc6 G T 17: 74,528,636 E29* probably null Het
Bnc2 T C 4: 84,414,326 N104S probably null Het
C030048H21Rik T C 2: 26,257,503 probably null Het
Cd320 G T 17: 33,847,639 C117F probably damaging Het
Cdkal1 A G 13: 29,326,150 S542P probably damaging Het
Crocc T C 4: 141,019,737 T1587A probably benign Het
Defb41 T C 1: 18,260,593 probably null Het
Dmtf1 A G 5: 9,140,384 probably null Het
Dnhd1 A G 7: 105,704,148 N2836S probably benign Het
Dpp8 G A 9: 65,078,748 S840N probably benign Het
Dsc2 A G 18: 20,034,701 F111L probably damaging Het
Dsc2 T A 18: 20,045,565 I261F probably benign Het
Ece1 T C 4: 137,951,508 V509A probably benign Het
Ecm2 T C 13: 49,518,332 M103T possibly damaging Het
Emsy T C 7: 98,590,856 H1064R probably damaging Het
Engase T C 11: 118,487,140 V252A possibly damaging Het
F13b A G 1: 139,510,965 Y369C probably damaging Het
Flii T C 11: 60,721,606 probably null Het
Fzd10 T A 5: 128,602,559 F448I probably damaging Het
Gpr35 T G 1: 92,983,048 F161V probably damaging Het
Gprin2 T C 14: 34,195,273 D180G possibly damaging Het
Grik3 A G 4: 125,670,728 N501S probably benign Het
Hells A G 19: 38,967,765 K802E probably damaging Het
Il1r1 T A 1: 40,293,349 C96* probably null Het
Kcnk16 T A 14: 20,265,277 I73F probably damaging Het
Kcnq5 A G 1: 21,402,681 S652P probably benign Het
Lamc3 A G 2: 31,940,751 D1500G probably damaging Het
Macf1 A G 4: 123,378,480 F6468L probably damaging Het
Mgrn1 T A 16: 4,915,780 F198I probably benign Het
Mmp3 A G 9: 7,451,232 T323A probably benign Het
N4bp2 A G 5: 65,790,498 Y157C probably benign Het
Nfkbid C A 7: 30,425,356 H190Q probably benign Het
Olfr1474 T C 19: 13,471,680 S237P probably damaging Het
Olfr512 T C 7: 108,713,941 V184A possibly damaging Het
Olfr790 T C 10: 129,501,591 S236P probably damaging Het
Osgin2 C T 4: 15,998,380 G414D probably benign Het
Pkd1 G A 17: 24,594,853 R4097H probably benign Het
Pnkd T A 1: 74,349,809 L213Q probably null Het
Ppfibp1 A G 6: 147,027,432 H850R probably benign Het
Ppp6r1 T C 7: 4,643,258 D148G probably damaging Het
Ptprt A T 2: 162,238,034 S282T probably damaging Het
Sgsm3 T C 15: 81,010,256 V536A probably benign Het
Slc22a23 T A 13: 34,203,964 Q383L probably benign Het
Snx29 T C 16: 11,399,837 probably null Het
Tmem229b-ps T A 10: 53,475,446 noncoding transcript Het
Tmod4 A T 3: 95,128,679 Y317F possibly damaging Het
Trim13 T C 14: 61,605,659 M375T probably benign Het
Txndc11 A G 16: 11,075,062 S935P probably damaging Het
Umod T C 7: 119,465,497 N592D probably benign Het
Vmn2r118 A G 17: 55,610,643 Y290H probably benign Het
Vps26b A G 9: 27,012,745 M234T probably damaging Het
Zbtb48 A G 4: 152,020,201 probably null Het
Zfc3h1 T A 10: 115,416,742 F1320Y probably benign Het
Zfp784 A T 7: 5,036,040 probably benign Het
Other mutations in Akt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Akt2 APN 7 27636154 missense probably damaging 1.00
IGL01981:Akt2 APN 7 27638074 missense probably benign 0.04
IGL02340:Akt2 APN 7 27629399 missense probably damaging 1.00
IGL02794:Akt2 APN 7 27629381 missense probably benign 0.00
sessile UTSW 7 27633241 missense probably damaging 1.00
Slothful UTSW 7 27616349 missense possibly damaging 0.95
R0013:Akt2 UTSW 7 27636058 missense probably damaging 1.00
R0129:Akt2 UTSW 7 27636970 missense probably damaging 1.00
R0355:Akt2 UTSW 7 27636909 splice site probably benign
R2207:Akt2 UTSW 7 27637200 splice site probably null
R2921:Akt2 UTSW 7 27628986 missense probably benign 0.01
R4953:Akt2 UTSW 7 27638172 unclassified probably null
R5495:Akt2 UTSW 7 27636169 critical splice donor site probably null
R5577:Akt2 UTSW 7 27636306 missense probably damaging 1.00
R6494:Akt2 UTSW 7 27616349 missense possibly damaging 0.95
R6987:Akt2 UTSW 7 27633241 missense probably damaging 1.00
R7034:Akt2 UTSW 7 27637012 critical splice donor site probably null
R7036:Akt2 UTSW 7 27637012 critical splice donor site probably null
R7461:Akt2 UTSW 7 27637170 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGCAAACTCGGTGCAGTGCAG -3'
(R):5'- TGACGATCCTTACAGCAACAGCAG -3'

Sequencing Primer
(F):5'- CATGGAGCATAGATTCTTCCTCAG -3'
(R):5'- TTACAGCAACAGCAGGCTTTG -3'
Posted On2014-04-13