Incidental Mutation 'R1515:Mmp3'
ID168228
Institutional Source Beutler Lab
Gene Symbol Mmp3
Ensembl Gene ENSMUSG00000043613
Gene Namematrix metallopeptidase 3
SynonymsStmy1, Str1, stromelysin 1, SLN-1, stromelysin-1, STR-1, progelatinase, SLN1
MMRRC Submission 039562-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R1515 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location7445822-7455975 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7451232 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 323 (T323A)
Ref Sequence ENSEMBL: ENSMUSP00000034497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034497]
Predicted Effect probably benign
Transcript: ENSMUST00000034497
AA Change: T323A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000034497
Gene: ENSMUSG00000043613
AA Change: T323A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:PG_binding_1 29 89 1.7e-12 PFAM
ZnMc 107 267 6.24e-65 SMART
HX 298 340 4.56e-9 SMART
HX 342 385 2.87e-6 SMART
HX 390 437 4.73e-16 SMART
HX 439 479 3.3e-6 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded protein is activated by the removal of an N-temrinal activation peptide to generate a zinc-dependent endopeptidase with a broad range of substrates such as proteoglycans, laminin, fibronectin, elastin, and collagens. This gene is located in a cluster of other matrix metalloproteinase genes on chromosome 9. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for disrutptions in this gene display abnormalities of the immune system as well as minor structural abnormalities in the neuromuscular junction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt2 A G 7: 27,637,158 T401A probably damaging Het
Arhgap32 G T 9: 32,116,202 V23L probably benign Het
Atmin T A 8: 116,954,840 C193S possibly damaging Het
Atp13a5 C T 16: 29,333,974 V225I probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
BC024139 A G 15: 76,124,326 V350A possibly damaging Het
Birc6 G T 17: 74,528,636 E29* probably null Het
Bnc2 T C 4: 84,414,326 N104S probably null Het
C030048H21Rik T C 2: 26,257,503 probably null Het
Cd320 G T 17: 33,847,639 C117F probably damaging Het
Cdkal1 A G 13: 29,326,150 S542P probably damaging Het
Crocc T C 4: 141,019,737 T1587A probably benign Het
Defb41 T C 1: 18,260,593 probably null Het
Dmtf1 A G 5: 9,140,384 probably null Het
Dnhd1 A G 7: 105,704,148 N2836S probably benign Het
Dpp8 G A 9: 65,078,748 S840N probably benign Het
Dsc2 T A 18: 20,045,565 I261F probably benign Het
Dsc2 A G 18: 20,034,701 F111L probably damaging Het
Ece1 T C 4: 137,951,508 V509A probably benign Het
Ecm2 T C 13: 49,518,332 M103T possibly damaging Het
Emsy T C 7: 98,590,856 H1064R probably damaging Het
Engase T C 11: 118,487,140 V252A possibly damaging Het
F13b A G 1: 139,510,965 Y369C probably damaging Het
Flii T C 11: 60,721,606 probably null Het
Fzd10 T A 5: 128,602,559 F448I probably damaging Het
Gpr35 T G 1: 92,983,048 F161V probably damaging Het
Gprin2 T C 14: 34,195,273 D180G possibly damaging Het
Grik3 A G 4: 125,670,728 N501S probably benign Het
Hells A G 19: 38,967,765 K802E probably damaging Het
Il1r1 T A 1: 40,293,349 C96* probably null Het
Kcnk16 T A 14: 20,265,277 I73F probably damaging Het
Kcnq5 A G 1: 21,402,681 S652P probably benign Het
Lamc3 A G 2: 31,940,751 D1500G probably damaging Het
Macf1 A G 4: 123,378,480 F6468L probably damaging Het
Mgrn1 T A 16: 4,915,780 F198I probably benign Het
N4bp2 A G 5: 65,790,498 Y157C probably benign Het
Nfkbid C A 7: 30,425,356 H190Q probably benign Het
Olfr1474 T C 19: 13,471,680 S237P probably damaging Het
Olfr512 T C 7: 108,713,941 V184A possibly damaging Het
Olfr790 T C 10: 129,501,591 S236P probably damaging Het
Osgin2 C T 4: 15,998,380 G414D probably benign Het
Pkd1 G A 17: 24,594,853 R4097H probably benign Het
Pnkd T A 1: 74,349,809 L213Q probably null Het
Ppfibp1 A G 6: 147,027,432 H850R probably benign Het
Ppp6r1 T C 7: 4,643,258 D148G probably damaging Het
Ptprt A T 2: 162,238,034 S282T probably damaging Het
Sgsm3 T C 15: 81,010,256 V536A probably benign Het
Slc22a23 T A 13: 34,203,964 Q383L probably benign Het
Snx29 T C 16: 11,399,837 probably null Het
Tmem229b-ps T A 10: 53,475,446 noncoding transcript Het
Tmod4 A T 3: 95,128,679 Y317F possibly damaging Het
Trim13 T C 14: 61,605,659 M375T probably benign Het
Txndc11 A G 16: 11,075,062 S935P probably damaging Het
Umod T C 7: 119,465,497 N592D probably benign Het
Vmn2r118 A G 17: 55,610,643 Y290H probably benign Het
Vps26b A G 9: 27,012,745 M234T probably damaging Het
Zbtb48 A G 4: 152,020,201 probably null Het
Zfc3h1 T A 10: 115,416,742 F1320Y probably benign Het
Zfp784 A T 7: 5,036,040 probably benign Het
Other mutations in Mmp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Mmp3 APN 9 7445894 utr 5 prime probably benign
IGL01738:Mmp3 APN 9 7446946 missense possibly damaging 0.94
IGL02154:Mmp3 APN 9 7453662 missense probably benign 0.19
IGL02212:Mmp3 APN 9 7450165 missense probably damaging 1.00
IGL02568:Mmp3 APN 9 7446001 missense probably benign 0.02
IGL03366:Mmp3 APN 9 7450149 missense probably benign 0.00
R0047:Mmp3 UTSW 9 7451910 splice site probably benign
R0047:Mmp3 UTSW 9 7451910 splice site probably benign
R0356:Mmp3 UTSW 9 7451768 missense probably benign 0.03
R0390:Mmp3 UTSW 9 7451320 missense probably benign 0.29
R0401:Mmp3 UTSW 9 7449790 missense probably damaging 1.00
R0466:Mmp3 UTSW 9 7450165 missense probably damaging 1.00
R0549:Mmp3 UTSW 9 7455638 missense probably benign 0.08
R0903:Mmp3 UTSW 9 7445994 missense probably benign 0.00
R1438:Mmp3 UTSW 9 7453705 missense probably benign 0.22
R1498:Mmp3 UTSW 9 7446967 missense possibly damaging 0.95
R1629:Mmp3 UTSW 9 7447641 missense probably benign 0.00
R1844:Mmp3 UTSW 9 7453662 missense probably benign 0.19
R1858:Mmp3 UTSW 9 7451799 missense probably benign 0.08
R2099:Mmp3 UTSW 9 7453672 missense probably benign 0.01
R2497:Mmp3 UTSW 9 7450131 missense probably benign 0.00
R2571:Mmp3 UTSW 9 7451844 missense possibly damaging 0.95
R4659:Mmp3 UTSW 9 7453673 missense probably benign 0.00
R4687:Mmp3 UTSW 9 7451223 missense probably benign 0.03
R4717:Mmp3 UTSW 9 7449881 missense possibly damaging 0.94
R4930:Mmp3 UTSW 9 7447640 missense probably benign 0.02
R4932:Mmp3 UTSW 9 7446994 missense probably benign 0.00
R5020:Mmp3 UTSW 9 7445984 missense probably benign
R5384:Mmp3 UTSW 9 7451759 nonsense probably null
R5385:Mmp3 UTSW 9 7451759 nonsense probably null
R5408:Mmp3 UTSW 9 7449904 missense probably damaging 0.98
R6268:Mmp3 UTSW 9 7447622 missense possibly damaging 0.78
R7317:Mmp3 UTSW 9 7446937 missense probably damaging 1.00
R7467:Mmp3 UTSW 9 7447621 missense possibly damaging 0.93
R7467:Mmp3 UTSW 9 7450125 missense probably benign 0.07
X0022:Mmp3 UTSW 9 7449857 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- AGCCCAGAATGGCCTGGAAATTG -3'
(R):5'- AGAGGCTTGTCTCACTAAGTTAAAGCG -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- TGTTGGATGGAAGAGATGGC -3'
Posted On2014-04-13