Incidental Mutation 'R1515:Engase'
ID168236
Institutional Source Beutler Lab
Gene Symbol Engase
Ensembl Gene ENSMUSG00000033857
Gene Nameendo-beta-N-acetylglucosaminidase
Synonyms
MMRRC Submission 039562-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R1515 (G1)
Quality Score222
Status Not validated
Chromosome11
Chromosomal Location118476829-118489209 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118487140 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 252 (V252A)
Ref Sequence ENSEMBL: ENSMUSP00000125886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017576] [ENSMUST00000043447] [ENSMUST00000069343] [ENSMUST00000103023] [ENSMUST00000106278] [ENSMUST00000117731] [ENSMUST00000120061] [ENSMUST00000135383] [ENSMUST00000139917] [ENSMUST00000166995] [ENSMUST00000168689] [ENSMUST00000171769]
Predicted Effect probably benign
Transcript: ENSMUST00000017576
SMART Domains Protein: ENSMUSP00000017576
Gene: ENSMUSG00000025576

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 171 1.01e-24 SMART
Pfam:Fox-1_C 208 269 1e-22 PFAM
Pfam:Fox-1_C 279 345 3.9e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043447
Predicted Effect probably benign
Transcript: ENSMUST00000069343
SMART Domains Protein: ENSMUSP00000069598
Gene: ENSMUSG00000025576

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 165 8.3e-2 SMART
Pfam:Fox-1_C 176 229 4.1e-15 PFAM
Pfam:Fox-1_C 226 314 4.8e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103023
SMART Domains Protein: ENSMUSP00000099312
Gene: ENSMUSG00000025576

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 171 1.01e-24 SMART
Pfam:Fox-1_C 207 298 4.2e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106278
SMART Domains Protein: ENSMUSP00000101885
Gene: ENSMUSG00000025576

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 171 1.01e-24 SMART
Pfam:Fox-1_C 207 298 4.2e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117731
SMART Domains Protein: ENSMUSP00000113636
Gene: ENSMUSG00000025576

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 171 1.01e-24 SMART
Pfam:Fox-1_C 207 260 3.5e-15 PFAM
Pfam:Fox-1_C 257 345 4.3e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120061
SMART Domains Protein: ENSMUSP00000113987
Gene: ENSMUSG00000025576

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 171 1.01e-24 SMART
Pfam:Fox-1_C 207 298 6.1e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135383
AA Change: V613A

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117538
Gene: ENSMUSG00000033857
AA Change: V613A

DomainStartEndE-ValueType
low complexity region 30 40 N/A INTRINSIC
low complexity region 102 120 N/A INTRINSIC
Pfam:Glyco_hydro_85 127 404 2.6e-101 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139813
Predicted Effect probably benign
Transcript: ENSMUST00000139917
SMART Domains Protein: ENSMUSP00000129698
Gene: ENSMUSG00000033857

DomainStartEndE-ValueType
low complexity region 30 40 N/A INTRINSIC
low complexity region 79 92 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166995
SMART Domains Protein: ENSMUSP00000127862
Gene: ENSMUSG00000033857

DomainStartEndE-ValueType
low complexity region 30 40 N/A INTRINSIC
low complexity region 102 120 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000168689
AA Change: V252A

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125886
Gene: ENSMUSG00000033857
AA Change: V252A

DomainStartEndE-ValueType
PDB:3FHA|D 13 143 1e-5 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168785
Predicted Effect probably benign
Transcript: ENSMUST00000171769
SMART Domains Protein: ENSMUSP00000132734
Gene: ENSMUSG00000033857

DomainStartEndE-ValueType
low complexity region 30 40 N/A INTRINSIC
low complexity region 79 92 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic enzyme which catalyzes the hydrolysis of peptides and proteins with mannose modifications to produce free oligosaccharides. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozgyous for knock-out alleles of this gene and Ngly1 exhibit restored endoplasmic reticulum (ER)-associated degradation (ERAD) process compared with MEFs lacking only Ngly1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt2 A G 7: 27,637,158 T401A probably damaging Het
Arhgap32 G T 9: 32,116,202 V23L probably benign Het
Atmin T A 8: 116,954,840 C193S possibly damaging Het
Atp13a5 C T 16: 29,333,974 V225I probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
BC024139 A G 15: 76,124,326 V350A possibly damaging Het
Birc6 G T 17: 74,528,636 E29* probably null Het
Bnc2 T C 4: 84,414,326 N104S probably null Het
C030048H21Rik T C 2: 26,257,503 probably null Het
Cd320 G T 17: 33,847,639 C117F probably damaging Het
Cdkal1 A G 13: 29,326,150 S542P probably damaging Het
Crocc T C 4: 141,019,737 T1587A probably benign Het
Defb41 T C 1: 18,260,593 probably null Het
Dmtf1 A G 5: 9,140,384 probably null Het
Dnhd1 A G 7: 105,704,148 N2836S probably benign Het
Dpp8 G A 9: 65,078,748 S840N probably benign Het
Dsc2 A G 18: 20,034,701 F111L probably damaging Het
Dsc2 T A 18: 20,045,565 I261F probably benign Het
Ece1 T C 4: 137,951,508 V509A probably benign Het
Ecm2 T C 13: 49,518,332 M103T possibly damaging Het
Emsy T C 7: 98,590,856 H1064R probably damaging Het
F13b A G 1: 139,510,965 Y369C probably damaging Het
Flii T C 11: 60,721,606 probably null Het
Fzd10 T A 5: 128,602,559 F448I probably damaging Het
Gpr35 T G 1: 92,983,048 F161V probably damaging Het
Gprin2 T C 14: 34,195,273 D180G possibly damaging Het
Grik3 A G 4: 125,670,728 N501S probably benign Het
Hells A G 19: 38,967,765 K802E probably damaging Het
Il1r1 T A 1: 40,293,349 C96* probably null Het
Kcnk16 T A 14: 20,265,277 I73F probably damaging Het
Kcnq5 A G 1: 21,402,681 S652P probably benign Het
Lamc3 A G 2: 31,940,751 D1500G probably damaging Het
Macf1 A G 4: 123,378,480 F6468L probably damaging Het
Mgrn1 T A 16: 4,915,780 F198I probably benign Het
Mmp3 A G 9: 7,451,232 T323A probably benign Het
N4bp2 A G 5: 65,790,498 Y157C probably benign Het
Nfkbid C A 7: 30,425,356 H190Q probably benign Het
Olfr1474 T C 19: 13,471,680 S237P probably damaging Het
Olfr512 T C 7: 108,713,941 V184A possibly damaging Het
Olfr790 T C 10: 129,501,591 S236P probably damaging Het
Osgin2 C T 4: 15,998,380 G414D probably benign Het
Pkd1 G A 17: 24,594,853 R4097H probably benign Het
Pnkd T A 1: 74,349,809 L213Q probably null Het
Ppfibp1 A G 6: 147,027,432 H850R probably benign Het
Ppp6r1 T C 7: 4,643,258 D148G probably damaging Het
Ptprt A T 2: 162,238,034 S282T probably damaging Het
Sgsm3 T C 15: 81,010,256 V536A probably benign Het
Slc22a23 T A 13: 34,203,964 Q383L probably benign Het
Snx29 T C 16: 11,399,837 probably null Het
Tmem229b-ps T A 10: 53,475,446 noncoding transcript Het
Tmod4 A T 3: 95,128,679 Y317F possibly damaging Het
Trim13 T C 14: 61,605,659 M375T probably benign Het
Txndc11 A G 16: 11,075,062 S935P probably damaging Het
Umod T C 7: 119,465,497 N592D probably benign Het
Vmn2r118 A G 17: 55,610,643 Y290H probably benign Het
Vps26b A G 9: 27,012,745 M234T probably damaging Het
Zbtb48 A G 4: 152,020,201 probably null Het
Zfc3h1 T A 10: 115,416,742 F1320Y probably benign Het
Zfp784 A T 7: 5,036,040 probably benign Het
Other mutations in Engase
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Engase APN 11 118482970 missense possibly damaging 0.91
IGL00963:Engase APN 11 118482998 missense probably damaging 1.00
IGL02652:Engase APN 11 118478950 missense probably damaging 0.99
R0135:Engase UTSW 11 118484478 missense possibly damaging 0.68
R1337:Engase UTSW 11 118482574 missense possibly damaging 0.46
R1435:Engase UTSW 11 118484901 missense probably damaging 1.00
R1889:Engase UTSW 11 118478933 missense probably damaging 1.00
R1939:Engase UTSW 11 118479186 missense probably damaging 1.00
R4628:Engase UTSW 11 118484905 missense probably damaging 1.00
R4730:Engase UTSW 11 118482922 missense probably damaging 1.00
R4762:Engase UTSW 11 118487094 missense possibly damaging 0.89
R4775:Engase UTSW 11 118482671 missense probably benign 0.22
R5155:Engase UTSW 11 118481281 missense probably benign 0.25
R5271:Engase UTSW 11 118481397 missense probably damaging 0.99
R5688:Engase UTSW 11 118487320 missense possibly damaging 0.91
R6659:Engase UTSW 11 118481316 missense probably benign 0.07
R7104:Engase UTSW 11 118481295 missense probably damaging 0.98
R7233:Engase UTSW 11 118483001 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGCCTTGGAGAGATCCAGGTATG -3'
(R):5'- AGCTTCCTGAGTCACAGCCAGAAC -3'

Sequencing Primer
(F):5'- AGATCCAGGTATGTATGTGGGAG -3'
(R):5'- AAGAGCAGGACCGCCTTTC -3'
Posted On2014-04-13