Incidental Mutation 'R1515:Slc22a23'
ID168238
Institutional Source Beutler Lab
Gene Symbol Slc22a23
Ensembl Gene ENSMUSG00000038267
Gene Namesolute carrier family 22, member 23
Synonyms3110004L20Rik
MMRRC Submission 039562-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.250) question?
Stock #R1515 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location34179158-34345182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34203964 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 383 (Q383L)
Ref Sequence ENSEMBL: ENSMUSP00000042742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040336]
Predicted Effect probably benign
Transcript: ENSMUST00000040336
AA Change: Q383L

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000042742
Gene: ENSMUSG00000038267
AA Change: Q383L

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
Pfam:Sugar_tr 187 633 5e-26 PFAM
Pfam:MFS_1 224 518 2.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145038
SMART Domains Protein: ENSMUSP00000122376
Gene: ENSMUSG00000038267

DomainStartEndE-ValueType
low complexity region 86 97 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000148390
AA Change: Q267L
SMART Domains Protein: ENSMUSP00000122283
Gene: ENSMUSG00000038267
AA Change: Q267L

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
Pfam:Sugar_tr 71 510 1.4e-27 PFAM
Pfam:MFS_1 109 402 1.5e-12 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC22A23 belongs to a large family of transmembrane proteins that function as uniporters, symporters, and antiporters to transport organic ions across cell membranes (Jacobsson et al., 2007 [PubMed 17714910]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt2 A G 7: 27,637,158 T401A probably damaging Het
Arhgap32 G T 9: 32,116,202 V23L probably benign Het
Atmin T A 8: 116,954,840 C193S possibly damaging Het
Atp13a5 C T 16: 29,333,974 V225I probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
BC024139 A G 15: 76,124,326 V350A possibly damaging Het
Birc6 G T 17: 74,528,636 E29* probably null Het
Bnc2 T C 4: 84,414,326 N104S probably null Het
C030048H21Rik T C 2: 26,257,503 probably null Het
Cd320 G T 17: 33,847,639 C117F probably damaging Het
Cdkal1 A G 13: 29,326,150 S542P probably damaging Het
Crocc T C 4: 141,019,737 T1587A probably benign Het
Defb41 T C 1: 18,260,593 probably null Het
Dmtf1 A G 5: 9,140,384 probably null Het
Dnhd1 A G 7: 105,704,148 N2836S probably benign Het
Dpp8 G A 9: 65,078,748 S840N probably benign Het
Dsc2 A G 18: 20,034,701 F111L probably damaging Het
Dsc2 T A 18: 20,045,565 I261F probably benign Het
Ece1 T C 4: 137,951,508 V509A probably benign Het
Ecm2 T C 13: 49,518,332 M103T possibly damaging Het
Emsy T C 7: 98,590,856 H1064R probably damaging Het
Engase T C 11: 118,487,140 V252A possibly damaging Het
F13b A G 1: 139,510,965 Y369C probably damaging Het
Flii T C 11: 60,721,606 probably null Het
Fzd10 T A 5: 128,602,559 F448I probably damaging Het
Gpr35 T G 1: 92,983,048 F161V probably damaging Het
Gprin2 T C 14: 34,195,273 D180G possibly damaging Het
Grik3 A G 4: 125,670,728 N501S probably benign Het
Hells A G 19: 38,967,765 K802E probably damaging Het
Il1r1 T A 1: 40,293,349 C96* probably null Het
Kcnk16 T A 14: 20,265,277 I73F probably damaging Het
Kcnq5 A G 1: 21,402,681 S652P probably benign Het
Lamc3 A G 2: 31,940,751 D1500G probably damaging Het
Macf1 A G 4: 123,378,480 F6468L probably damaging Het
Mgrn1 T A 16: 4,915,780 F198I probably benign Het
Mmp3 A G 9: 7,451,232 T323A probably benign Het
N4bp2 A G 5: 65,790,498 Y157C probably benign Het
Nfkbid C A 7: 30,425,356 H190Q probably benign Het
Olfr1474 T C 19: 13,471,680 S237P probably damaging Het
Olfr512 T C 7: 108,713,941 V184A possibly damaging Het
Olfr790 T C 10: 129,501,591 S236P probably damaging Het
Osgin2 C T 4: 15,998,380 G414D probably benign Het
Pkd1 G A 17: 24,594,853 R4097H probably benign Het
Pnkd T A 1: 74,349,809 L213Q probably null Het
Ppfibp1 A G 6: 147,027,432 H850R probably benign Het
Ppp6r1 T C 7: 4,643,258 D148G probably damaging Het
Ptprt A T 2: 162,238,034 S282T probably damaging Het
Sgsm3 T C 15: 81,010,256 V536A probably benign Het
Snx29 T C 16: 11,399,837 probably null Het
Tmem229b-ps T A 10: 53,475,446 noncoding transcript Het
Tmod4 A T 3: 95,128,679 Y317F possibly damaging Het
Trim13 T C 14: 61,605,659 M375T probably benign Het
Txndc11 A G 16: 11,075,062 S935P probably damaging Het
Umod T C 7: 119,465,497 N592D probably benign Het
Vmn2r118 A G 17: 55,610,643 Y290H probably benign Het
Vps26b A G 9: 27,012,745 M234T probably damaging Het
Zbtb48 A G 4: 152,020,201 probably null Het
Zfc3h1 T A 10: 115,416,742 F1320Y probably benign Het
Zfp784 A T 7: 5,036,040 probably benign Het
Other mutations in Slc22a23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Slc22a23 APN 13 34305245 missense probably damaging 1.00
IGL01762:Slc22a23 APN 13 34204001 missense possibly damaging 0.71
IGL02496:Slc22a23 APN 13 34344485 missense possibly damaging 0.93
IGL02516:Slc22a23 APN 13 34203955 missense probably benign 0.02
IGL02831:Slc22a23 APN 13 34299069 missense possibly damaging 0.81
R0234:Slc22a23 UTSW 13 34183261 missense probably damaging 1.00
R0234:Slc22a23 UTSW 13 34183261 missense probably damaging 1.00
R0413:Slc22a23 UTSW 13 34183132 missense probably damaging 1.00
R0557:Slc22a23 UTSW 13 34344383 missense possibly damaging 0.50
R0558:Slc22a23 UTSW 13 34344383 missense possibly damaging 0.50
R0636:Slc22a23 UTSW 13 34299093 missense probably benign 0.01
R0676:Slc22a23 UTSW 13 34195479 missense probably damaging 0.98
R0739:Slc22a23 UTSW 13 34344383 missense possibly damaging 0.50
R0990:Slc22a23 UTSW 13 34195467 missense probably damaging 1.00
R2128:Slc22a23 UTSW 13 34203970 missense possibly damaging 0.76
R2147:Slc22a23 UTSW 13 34183007 missense probably benign 0.00
R3113:Slc22a23 UTSW 13 34183075 missense probably damaging 0.98
R3780:Slc22a23 UTSW 13 34344340 missense probably benign 0.14
R3945:Slc22a23 UTSW 13 34183126 missense probably damaging 0.98
R3946:Slc22a23 UTSW 13 34183126 missense probably damaging 0.98
R4056:Slc22a23 UTSW 13 34299004 nonsense probably null
R4095:Slc22a23 UTSW 13 34305206 missense probably damaging 1.00
R4854:Slc22a23 UTSW 13 34203941 missense probably benign
R5594:Slc22a23 UTSW 13 34305257 missense probably damaging 0.99
R5611:Slc22a23 UTSW 13 34305239 missense probably benign 0.00
R6167:Slc22a23 UTSW 13 34344559 missense probably damaging 0.97
R6927:Slc22a23 UTSW 13 34344379 missense probably benign 0.07
R6933:Slc22a23 UTSW 13 34305180 missense probably benign 0.08
R6960:Slc22a23 UTSW 13 34344157 critical splice donor site probably null
X0064:Slc22a23 UTSW 13 34344466 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCACCGTTGCCTTTCCAAAC -3'
(R):5'- TGAGTCTGCCCATGTGTCCTAAGAG -3'

Sequencing Primer
(F):5'- TTGCAAACCATATAGGCACAGG -3'
(R):5'- cttctcttcctttcccctctc -3'
Posted On2014-04-13