Incidental Mutation 'R1515:Atp13a5'
ID168250
Institutional Source Beutler Lab
Gene Symbol Atp13a5
Ensembl Gene ENSMUSG00000048939
Gene NameATPase type 13A5
SynonymsC630015F21Rik
MMRRC Submission 039562-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1515 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location29231851-29378732 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 29333974 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 225 (V225I)
Ref Sequence ENSEMBL: ENSMUSP00000114703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075806] [ENSMUST00000142681] [ENSMUST00000143373] [ENSMUST00000152040]
Predicted Effect probably benign
Transcript: ENSMUST00000075806
AA Change: V239I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000075204
Gene: ENSMUSG00000048939
AA Change: V239I

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 142 4.1e-31 PFAM
Cation_ATPase_N 163 223 8.78e0 SMART
Pfam:E1-E2_ATPase 228 475 1.5e-35 PFAM
Pfam:Hydrolase 480 759 2.7e-11 PFAM
Pfam:HAD 483 857 1.1e-28 PFAM
Pfam:Cation_ATPase 564 638 1.3e-6 PFAM
transmembrane domain 901 923 N/A INTRINSIC
transmembrane domain 933 950 N/A INTRINSIC
transmembrane domain 971 993 N/A INTRINSIC
transmembrane domain 1042 1061 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1129 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142681
AA Change: V239I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118627
Gene: ENSMUSG00000048939
AA Change: V239I

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 142 7.5e-25 PFAM
Cation_ATPase_N 163 223 8.78e0 SMART
Pfam:E1-E2_ATPase 229 475 1e-36 PFAM
Pfam:Hydrolase 480 860 5.9e-16 PFAM
Pfam:HAD 483 857 4e-27 PFAM
Pfam:Hydrolase_like2 565 638 3.7e-8 PFAM
transmembrane domain 901 923 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143373
SMART Domains Protein: ENSMUSP00000121208
Gene: ENSMUSG00000048939

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 142 1e-24 PFAM
Pfam:E1-E2_ATPase 196 430 3.2e-34 PFAM
Pfam:Hydrolase 435 815 9.1e-16 PFAM
Pfam:HAD 438 812 6.2e-27 PFAM
Pfam:Hydrolase_like2 520 593 4.8e-8 PFAM
transmembrane domain 856 878 N/A INTRINSIC
transmembrane domain 888 905 N/A INTRINSIC
transmembrane domain 926 948 N/A INTRINSIC
transmembrane domain 997 1016 N/A INTRINSIC
transmembrane domain 1025 1047 N/A INTRINSIC
transmembrane domain 1062 1084 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152040
AA Change: V225I

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114703
Gene: ENSMUSG00000048939
AA Change: V225I

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 143 1.4e-25 PFAM
Cation_ATPase_N 149 209 8.78e0 SMART
low complexity region 213 227 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice show a decreased mean percentage of natural killer cells when compared with controls. Male homozygous mutant mice exhibit impaired sensorimotor gating/attention during prepulse inhibition testing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt2 A G 7: 27,637,158 T401A probably damaging Het
Arhgap32 G T 9: 32,116,202 V23L probably benign Het
Atmin T A 8: 116,954,840 C193S possibly damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
BC024139 A G 15: 76,124,326 V350A possibly damaging Het
Birc6 G T 17: 74,528,636 E29* probably null Het
Bnc2 T C 4: 84,414,326 N104S probably null Het
C030048H21Rik T C 2: 26,257,503 probably null Het
Cd320 G T 17: 33,847,639 C117F probably damaging Het
Cdkal1 A G 13: 29,326,150 S542P probably damaging Het
Crocc T C 4: 141,019,737 T1587A probably benign Het
Defb41 T C 1: 18,260,593 probably null Het
Dmtf1 A G 5: 9,140,384 probably null Het
Dnhd1 A G 7: 105,704,148 N2836S probably benign Het
Dpp8 G A 9: 65,078,748 S840N probably benign Het
Dsc2 A G 18: 20,034,701 F111L probably damaging Het
Dsc2 T A 18: 20,045,565 I261F probably benign Het
Ece1 T C 4: 137,951,508 V509A probably benign Het
Ecm2 T C 13: 49,518,332 M103T possibly damaging Het
Emsy T C 7: 98,590,856 H1064R probably damaging Het
Engase T C 11: 118,487,140 V252A possibly damaging Het
F13b A G 1: 139,510,965 Y369C probably damaging Het
Flii T C 11: 60,721,606 probably null Het
Fzd10 T A 5: 128,602,559 F448I probably damaging Het
Gpr35 T G 1: 92,983,048 F161V probably damaging Het
Gprin2 T C 14: 34,195,273 D180G possibly damaging Het
Grik3 A G 4: 125,670,728 N501S probably benign Het
Hells A G 19: 38,967,765 K802E probably damaging Het
Il1r1 T A 1: 40,293,349 C96* probably null Het
Kcnk16 T A 14: 20,265,277 I73F probably damaging Het
Kcnq5 A G 1: 21,402,681 S652P probably benign Het
Lamc3 A G 2: 31,940,751 D1500G probably damaging Het
Macf1 A G 4: 123,378,480 F6468L probably damaging Het
Mgrn1 T A 16: 4,915,780 F198I probably benign Het
Mmp3 A G 9: 7,451,232 T323A probably benign Het
N4bp2 A G 5: 65,790,498 Y157C probably benign Het
Nfkbid C A 7: 30,425,356 H190Q probably benign Het
Olfr1474 T C 19: 13,471,680 S237P probably damaging Het
Olfr512 T C 7: 108,713,941 V184A possibly damaging Het
Olfr790 T C 10: 129,501,591 S236P probably damaging Het
Osgin2 C T 4: 15,998,380 G414D probably benign Het
Pkd1 G A 17: 24,594,853 R4097H probably benign Het
Pnkd T A 1: 74,349,809 L213Q probably null Het
Ppfibp1 A G 6: 147,027,432 H850R probably benign Het
Ppp6r1 T C 7: 4,643,258 D148G probably damaging Het
Ptprt A T 2: 162,238,034 S282T probably damaging Het
Sgsm3 T C 15: 81,010,256 V536A probably benign Het
Slc22a23 T A 13: 34,203,964 Q383L probably benign Het
Snx29 T C 16: 11,399,837 probably null Het
Tmem229b-ps T A 10: 53,475,446 noncoding transcript Het
Tmod4 A T 3: 95,128,679 Y317F possibly damaging Het
Trim13 T C 14: 61,605,659 M375T probably benign Het
Txndc11 A G 16: 11,075,062 S935P probably damaging Het
Umod T C 7: 119,465,497 N592D probably benign Het
Vmn2r118 A G 17: 55,610,643 Y290H probably benign Het
Vps26b A G 9: 27,012,745 M234T probably damaging Het
Zbtb48 A G 4: 152,020,201 probably null Het
Zfc3h1 T A 10: 115,416,742 F1320Y probably benign Het
Zfp784 A T 7: 5,036,040 probably benign Het
Other mutations in Atp13a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Atp13a5 APN 16 29267014 nonsense probably null
IGL00583:Atp13a5 APN 16 29275453 splice site probably benign
IGL01472:Atp13a5 APN 16 29275423 missense probably damaging 1.00
IGL01473:Atp13a5 APN 16 29316724 missense probably damaging 1.00
IGL02142:Atp13a5 APN 16 29234563 missense probably benign 0.01
IGL02346:Atp13a5 APN 16 29327736 nonsense probably null
IGL02454:Atp13a5 APN 16 29232808 missense probably benign 0.35
IGL02557:Atp13a5 APN 16 29248182 missense probably benign 0.24
IGL02651:Atp13a5 APN 16 29334091 splice site probably benign
IGL02697:Atp13a5 APN 16 29348532 missense probably benign
IGL02704:Atp13a5 APN 16 29251328 nonsense probably null
IGL02993:Atp13a5 APN 16 29293504 nonsense probably null
IGL03329:Atp13a5 APN 16 29334065 nonsense probably null
IGL03346:Atp13a5 APN 16 29314604 missense probably benign 0.15
IGL03493:Atp13a5 APN 16 29297524 missense probably benign
PIT4810001:Atp13a5 UTSW 16 29314564 missense probably damaging 1.00
R0356:Atp13a5 UTSW 16 29348755 splice site probably benign
R0393:Atp13a5 UTSW 16 29266929 splice site probably benign
R0456:Atp13a5 UTSW 16 29232740 missense probably benign 0.03
R0526:Atp13a5 UTSW 16 29348740 missense probably damaging 0.97
R0632:Atp13a5 UTSW 16 29298208 missense probably benign 0.00
R0674:Atp13a5 UTSW 16 29248350 splice site probably benign
R1417:Atp13a5 UTSW 16 29298235 missense probably benign 0.00
R1470:Atp13a5 UTSW 16 29349015 missense probably benign 0.19
R1470:Atp13a5 UTSW 16 29349015 missense probably benign 0.19
R1659:Atp13a5 UTSW 16 29293433 missense probably benign
R1723:Atp13a5 UTSW 16 29232799 missense possibly damaging 0.88
R1779:Atp13a5 UTSW 16 29314660 missense possibly damaging 0.67
R1794:Atp13a5 UTSW 16 29321709 missense probably damaging 1.00
R1958:Atp13a5 UTSW 16 29314601 missense probably damaging 1.00
R2218:Atp13a5 UTSW 16 29321646 missense probably damaging 0.99
R2282:Atp13a5 UTSW 16 29237321 missense probably damaging 1.00
R2356:Atp13a5 UTSW 16 29281069 missense probably damaging 1.00
R2365:Atp13a5 UTSW 16 29251256 missense probably benign 0.00
R2497:Atp13a5 UTSW 16 29339071 nonsense probably null
R2517:Atp13a5 UTSW 16 29297397 missense possibly damaging 0.79
R3552:Atp13a5 UTSW 16 29310766 missense probably damaging 1.00
R3685:Atp13a5 UTSW 16 29316755 missense probably damaging 1.00
R3957:Atp13a5 UTSW 16 29298194 missense probably benign 0.01
R4433:Atp13a5 UTSW 16 29282024 missense probably damaging 0.99
R4503:Atp13a5 UTSW 16 29293528 missense probably benign 0.37
R4579:Atp13a5 UTSW 16 29248338 critical splice acceptor site probably null
R4632:Atp13a5 UTSW 16 29348719 missense probably damaging 1.00
R4718:Atp13a5 UTSW 16 29248170 missense probably damaging 1.00
R4865:Atp13a5 UTSW 16 29248160 missense probably damaging 0.98
R4899:Atp13a5 UTSW 16 29378500 missense probably damaging 1.00
R4909:Atp13a5 UTSW 16 29334028 missense possibly damaging 0.81
R5011:Atp13a5 UTSW 16 29350748 missense probably damaging 1.00
R5013:Atp13a5 UTSW 16 29350748 missense probably damaging 1.00
R5032:Atp13a5 UTSW 16 29263450 missense probably damaging 1.00
R5226:Atp13a5 UTSW 16 29248279 missense probably damaging 1.00
R5485:Atp13a5 UTSW 16 29281942 critical splice donor site probably null
R5598:Atp13a5 UTSW 16 29257077 intron probably benign
R5945:Atp13a5 UTSW 16 29237243 missense probably benign 0.06
R5958:Atp13a5 UTSW 16 29339042 missense probably damaging 1.00
R6194:Atp13a5 UTSW 16 29308239 missense probably damaging 1.00
R6214:Atp13a5 UTSW 16 29251407 missense probably damaging 1.00
R6273:Atp13a5 UTSW 16 29348737 missense probably benign 0.10
R6376:Atp13a5 UTSW 16 29237252 missense probably benign 0.00
R6431:Atp13a5 UTSW 16 29251402 missense possibly damaging 0.93
R6495:Atp13a5 UTSW 16 29321622 critical splice donor site probably null
R6619:Atp13a5 UTSW 16 29349015 missense probably benign 0.05
R6853:Atp13a5 UTSW 16 29321662 missense possibly damaging 0.94
R6932:Atp13a5 UTSW 16 29281951 missense probably damaging 1.00
R7070:Atp13a5 UTSW 16 29334061 missense possibly damaging 0.88
R7343:Atp13a5 UTSW 16 29321749 missense probably benign 0.01
R7425:Atp13a5 UTSW 16 29297460 nonsense probably null
R7570:Atp13a5 UTSW 16 29266963 missense probably damaging 1.00
X0023:Atp13a5 UTSW 16 29310782 missense probably damaging 1.00
Z1088:Atp13a5 UTSW 16 29282062 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GCCTGCTGCTGCCTTATGAATTG -3'
(R):5'- GGAGGGTTTTAACCTGGAAACTGCC -3'

Sequencing Primer
(F):5'- CTGCCTTATGAATTGTGTGTGAC -3'
(R):5'- CTGCCTCACAGCATATGAATAAATGG -3'
Posted On2014-04-13