Incidental Mutation 'R1512:Prex2'
ID168379
Institutional Source Beutler Lab
Gene Symbol Prex2
Ensembl Gene ENSMUSG00000048960
Gene Namephosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
SynonymsC030045D06Rik, 6230420N16Rik, Depdc2
MMRRC Submission 039559-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R1512 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location10993465-11303681 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11061330 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 41 (F41S)
Ref Sequence ENSEMBL: ENSMUSP00000027056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027056]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027056
AA Change: F41S

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000027056
Gene: ENSMUSG00000048960
AA Change: F41S

DomainStartEndE-ValueType
RhoGEF 19 205 8.61e-45 SMART
PH 238 355 2.43e-12 SMART
DEP 383 456 4.46e-26 SMART
DEP 484 557 6.57e-15 SMART
PDZ 593 666 9.62e-2 SMART
PDZ 677 744 6.37e-8 SMART
low complexity region 1112 1127 N/A INTRINSIC
low complexity region 1498 1507 N/A INTRINSIC
Meta Mutation Damage Score 0.344 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency 95% (79/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphatidylinositol 3,4,5-trisphosphate (PIP3)-dependent Rac exchanger (PREX) family, which are Dbl-type guanine-nucleotide exchange factors for Rac family small G proteins. Structural domains of this protein include the catalytic diffuse B-cell lymphoma homology and pleckstrin homology (DHPH) domain, two disheveled, EGL-10, and pleckstrin homology (DEP) domains, two PDZ domains, and a C-terminal inositol polyphosphate-4 phosphatase (IP4P) domain that is found in one of the isoforms. This protein facilitates the exchange of GDP for GTP on Rac1, allowing the GTP-bound Rac1 to activate downstream effectors. Studies also show that the pleckstrin homology domain of this protein interacts with the phosphatase and tensin homolog (PTEN) gene product to inhibit PTEN phosphatase activity, thus activating the phosphoinositide-3 kinase (PI3K) signaling pathway. Conversely, the PTEN gene product has also been shown to inhibit the GEF activity of this protein. This gene plays a role in insulin-signaling pathways, and either mutations or overexpression of this gene have been observed in some cancers. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for gene trapped alleles may exhibit abnormal Purkinje cell dendrite morphology, a mild motor coordination defect that progressively worsens with age, hypoactivity, impaired glucose tolerance and/or insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,195,469 D40E probably benign Het
Acsf2 C T 11: 94,561,398 probably benign Het
Adamts19 C T 18: 59,048,845 H1119Y possibly damaging Het
Akap6 A G 12: 52,937,154 D827G probably damaging Het
Ankrd33b T C 15: 31,367,229 D55G probably damaging Het
Ano5 T A 7: 51,579,568 H569Q probably benign Het
Aox2 A G 1: 58,307,351 D548G probably benign Het
Baz2a A G 10: 128,124,152 D1433G possibly damaging Het
BC031181 T G 18: 75,008,696 V8G probably damaging Het
Bicdl2 A T 17: 23,668,109 M457L probably damaging Het
C130074G19Rik T C 1: 184,882,906 D29G probably damaging Het
Cd200r1 A T 16: 44,766,027 T7S probably benign Het
Cdc37 A G 9: 21,142,416 probably benign Het
Cmtr2 T C 8: 110,222,635 S526P probably damaging Het
Cntn2 G T 1: 132,523,692 A433D probably damaging Het
Cntnap5a T C 1: 115,900,950 S35P probably benign Het
Csf3r A G 4: 126,029,984 T96A possibly damaging Het
Ctbs A G 3: 146,454,965 N96D probably benign Het
Cyp26b1 C A 6: 84,576,997 V213L probably benign Het
Dach1 A G 14: 97,901,399 L536P probably damaging Het
Dcaf6 T C 1: 165,352,020 Q517R probably benign Het
Dnah1 G T 14: 31,293,037 Q1733K probably damaging Het
Dnah17 A T 11: 118,095,015 I1416N probably benign Het
Dock11 G A X: 36,020,035 R1102H probably damaging Het
Dpp8 T C 9: 65,063,814 probably benign Het
Emc1 G A 4: 139,360,184 probably null Het
Emc8 A G 8: 120,658,244 L76P possibly damaging Het
Emx2 T C 19: 59,459,603 Y130H possibly damaging Het
Fbf1 C T 11: 116,147,927 R815Q probably damaging Het
Foxb2 G A 19: 16,872,514 P376L probably damaging Het
Gabrb1 C A 5: 72,108,704 L202I probably damaging Het
Gabrb1 T A 5: 72,108,705 L202Q probably damaging Het
Grin2c T A 11: 115,253,850 I617F probably damaging Het
Gtf2h3 T A 5: 124,590,870 V164E probably damaging Het
Gusb T C 5: 130,000,890 Q88R probably damaging Het
Hormad2 T A 11: 4,424,788 K75N probably damaging Het
Il33 A G 19: 29,951,990 T38A possibly damaging Het
Ivns1abp A T 1: 151,360,936 Q416L possibly damaging Het
Ivns1abp G C 1: 151,360,937 Q416H probably benign Het
Kcnh5 T A 12: 75,119,937 H178L probably benign Het
Kif21b A G 1: 136,152,805 N579S probably benign Het
Kif26a G C 12: 112,146,955 R95P possibly damaging Het
Kl A G 5: 150,988,597 I604V probably benign Het
Klhl24 A G 16: 20,122,936 K545E probably damaging Het
Mcm3ap A G 10: 76,470,513 I153M probably damaging Het
Meis1 T G 11: 18,881,682 D452A probably damaging Het
Msantd4 C T 9: 4,384,138 P153L probably benign Het
Myot A G 18: 44,342,355 E181G probably damaging Het
Nf1 T C 11: 79,390,369 F150S probably damaging Het
Nyap2 T A 1: 81,241,851 S529R probably damaging Het
Olfr1145 A T 2: 87,810,644 T275S probably benign Het
Olfr1386 A G 11: 49,470,459 I103V probably benign Het
Olfr923 T A 9: 38,828,364 Y224* probably null Het
Olfr958 T C 9: 39,550,094 Y259C probably damaging Het
Pcnt C T 10: 76,404,662 probably null Het
Pik3c3 T C 18: 30,322,236 probably null Het
Pkdcc A T 17: 83,220,044 Y217F possibly damaging Het
Pnpla6 C A 8: 3,535,459 probably benign Het
Polr3gl T C 3: 96,580,874 M26V probably benign Het
Ppp1r13b T C 12: 111,872,408 N12S possibly damaging Het
Ppp1r26 G A 2: 28,451,516 R386K probably benign Het
Prdm10 A G 9: 31,337,401 E355G probably damaging Het
Prkar1b G T 5: 139,050,673 Y231* probably null Het
Prkdc A T 16: 15,687,404 I857L probably benign Het
Psg21 A T 7: 18,656,500 N10K probably benign Het
Rapgef3 A T 15: 97,757,501 V444E probably benign Het
Rnf17 A T 14: 56,467,786 T716S probably benign Het
Rps6ka1 C T 4: 133,851,004 R577H probably damaging Het
Scn1a A C 2: 66,331,285 N306K possibly damaging Het
Skint6 A G 4: 113,238,132 I110T probably damaging Het
Ssu2 A G 6: 112,387,998 M1T probably null Het
Stag3 A T 5: 138,297,985 T437S probably benign Het
Tal2 A G 4: 53,786,107 Y96C probably benign Het
Thoc3 A T 13: 54,466,178 probably null Het
Tle1 T C 4: 72,141,258 D19G probably damaging Het
Trpm4 A G 7: 45,315,044 I690T probably benign Het
Trpm6 A T 19: 18,875,931 M1772L probably benign Het
Unc5b G A 10: 60,831,475 probably benign Het
Usf3 G T 16: 44,221,198 V2014F probably damaging Het
Utp18 C T 11: 93,885,564 A32T probably benign Het
Wdfy4 A G 14: 32,960,808 V2981A probably damaging Het
Zfp608 A G 18: 54,946,666 V349A probably damaging Het
Znfx1 A C 2: 167,056,317 I229S probably benign Het
Other mutations in Prex2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Prex2 APN 1 11186652 missense possibly damaging 0.51
IGL00948:Prex2 APN 1 11170614 missense probably damaging 0.98
IGL01087:Prex2 APN 1 11068104 missense probably benign 0.00
IGL01490:Prex2 APN 1 11184545 splice site probably null
IGL01533:Prex2 APN 1 11186741 nonsense probably null
IGL01661:Prex2 APN 1 11208614 missense probably benign 0.01
IGL01668:Prex2 APN 1 11153645 missense probably benign 0.00
IGL01674:Prex2 APN 1 11170741 missense probably damaging 1.00
IGL01716:Prex2 APN 1 11266054 missense probably benign 0.04
IGL01867:Prex2 APN 1 11098503 missense probably benign 0.11
IGL01954:Prex2 APN 1 11140011 missense possibly damaging 0.75
IGL01990:Prex2 APN 1 11123233 splice site probably benign
IGL02022:Prex2 APN 1 11297739 missense probably benign 0.04
IGL02130:Prex2 APN 1 11112799 missense probably damaging 1.00
IGL02130:Prex2 APN 1 11160162 missense probably damaging 1.00
IGL02221:Prex2 APN 1 11061345 missense probably benign 0.00
IGL02369:Prex2 APN 1 11101169 critical splice donor site probably null
IGL02440:Prex2 APN 1 11153657 missense possibly damaging 0.94
IGL02477:Prex2 APN 1 11204154 missense probably benign
IGL02492:Prex2 APN 1 11123845 missense possibly damaging 0.93
IGL03051:Prex2 APN 1 11142665 missense probably damaging 1.00
IGL03154:Prex2 APN 1 11153633 missense possibly damaging 0.63
IGL03158:Prex2 APN 1 11266067 missense possibly damaging 0.89
IGL03308:Prex2 APN 1 11185175 missense possibly damaging 0.89
IGL03338:Prex2 APN 1 11140265 missense probably benign 0.01
R0042:Prex2 UTSW 1 11080081 missense probably damaging 1.00
R0052:Prex2 UTSW 1 11160156 missense probably damaging 1.00
R0052:Prex2 UTSW 1 11160156 missense probably damaging 1.00
R0138:Prex2 UTSW 1 11285043 splice site probably benign
R0206:Prex2 UTSW 1 11285144 missense probably damaging 1.00
R0206:Prex2 UTSW 1 11285144 missense probably damaging 1.00
R0208:Prex2 UTSW 1 11285144 missense probably damaging 1.00
R0325:Prex2 UTSW 1 11200057 splice site probably null
R0326:Prex2 UTSW 1 11285065 missense probably damaging 1.00
R0390:Prex2 UTSW 1 11089706 splice site probably null
R0492:Prex2 UTSW 1 11186633 splice site probably benign
R0512:Prex2 UTSW 1 11199933 missense probably benign
R0515:Prex2 UTSW 1 11199874 missense probably damaging 0.99
R0894:Prex2 UTSW 1 11181898 missense probably benign
R1259:Prex2 UTSW 1 11289270 missense probably damaging 1.00
R1332:Prex2 UTSW 1 11204091 missense probably damaging 1.00
R1356:Prex2 UTSW 1 11080092 nonsense probably null
R1451:Prex2 UTSW 1 11156259 missense probably benign 0.01
R1488:Prex2 UTSW 1 11193528 missense probably benign 0.05
R1641:Prex2 UTSW 1 11231772 missense probably damaging 0.99
R1667:Prex2 UTSW 1 11186757 missense probably benign
R1678:Prex2 UTSW 1 11285089 missense possibly damaging 0.51
R1736:Prex2 UTSW 1 11089884 splice site probably benign
R1781:Prex2 UTSW 1 11199955 missense probably benign 0.17
R1804:Prex2 UTSW 1 11132342 missense probably damaging 1.00
R1836:Prex2 UTSW 1 11136780 missense probably damaging 1.00
R1899:Prex2 UTSW 1 11162366 nonsense probably null
R1900:Prex2 UTSW 1 11162366 nonsense probably null
R2020:Prex2 UTSW 1 11162312 missense probably damaging 0.98
R2114:Prex2 UTSW 1 11186713 missense probably damaging 1.00
R2117:Prex2 UTSW 1 11186713 missense probably damaging 1.00
R2436:Prex2 UTSW 1 11266152 missense possibly damaging 0.90
R2902:Prex2 UTSW 1 11208614 missense possibly damaging 0.77
R2915:Prex2 UTSW 1 11169853 missense probably damaging 1.00
R2924:Prex2 UTSW 1 11098487 missense probably damaging 1.00
R2981:Prex2 UTSW 1 11181962 missense probably damaging 1.00
R3430:Prex2 UTSW 1 11149854 missense possibly damaging 0.88
R3832:Prex2 UTSW 1 11156364 splice site probably benign
R3870:Prex2 UTSW 1 11160192 missense possibly damaging 0.86
R3963:Prex2 UTSW 1 11110357 missense possibly damaging 0.93
R4012:Prex2 UTSW 1 11184516 missense probably benign
R4030:Prex2 UTSW 1 11208568 missense probably benign 0.06
R4214:Prex2 UTSW 1 11101159 missense probably damaging 1.00
R4214:Prex2 UTSW 1 11285061 missense probably damaging 1.00
R4242:Prex2 UTSW 1 11156304 missense probably benign 0.06
R4490:Prex2 UTSW 1 11162263 missense probably benign 0.05
R4491:Prex2 UTSW 1 11162263 missense probably benign 0.05
R4492:Prex2 UTSW 1 11162263 missense probably benign 0.05
R4561:Prex2 UTSW 1 11184545 splice site probably null
R4624:Prex2 UTSW 1 11289265 nonsense probably null
R4647:Prex2 UTSW 1 11162285 missense probably damaging 1.00
R4657:Prex2 UTSW 1 11065825 missense probably benign 0.00
R4706:Prex2 UTSW 1 11199988 missense probably damaging 1.00
R4806:Prex2 UTSW 1 11068020 missense probably damaging 1.00
R4900:Prex2 UTSW 1 11149905 splice site probably benign
R4922:Prex2 UTSW 1 11169940 missense probably damaging 1.00
R4961:Prex2 UTSW 1 11098481 missense possibly damaging 0.75
R5284:Prex2 UTSW 1 11266090 nonsense probably null
R5305:Prex2 UTSW 1 11107678 missense probably damaging 1.00
R5307:Prex2 UTSW 1 11200032 missense probably damaging 0.99
R5331:Prex2 UTSW 1 11140011 missense possibly damaging 0.75
R5385:Prex2 UTSW 1 11139980 missense probably damaging 0.99
R5574:Prex2 UTSW 1 11140058 missense probably damaging 1.00
R5979:Prex2 UTSW 1 11132372 missense probably damaging 1.00
R6076:Prex2 UTSW 1 11185950 missense probably benign 0.09
R6160:Prex2 UTSW 1 10993851 missense probably damaging 1.00
R6177:Prex2 UTSW 1 11136777 missense possibly damaging 0.49
R6221:Prex2 UTSW 1 11266012 missense probably benign 0.01
R6293:Prex2 UTSW 1 11162298 missense probably benign
R6335:Prex2 UTSW 1 11110320 missense probably benign 0.13
R6401:Prex2 UTSW 1 11186727 missense probably benign 0.00
R6427:Prex2 UTSW 1 11182031 missense probably damaging 1.00
R6467:Prex2 UTSW 1 11266035 missense probably damaging 1.00
R6564:Prex2 UTSW 1 11101061 splice site probably null
R6734:Prex2 UTSW 1 11080059 missense probably damaging 1.00
R6753:Prex2 UTSW 1 11184456 missense probably damaging 0.98
R6880:Prex2 UTSW 1 11132384 missense probably damaging 1.00
R6973:Prex2 UTSW 1 11112743 missense probably damaging 1.00
R6980:Prex2 UTSW 1 11162263 missense probably benign 0.05
R6987:Prex2 UTSW 1 11170752 missense probably damaging 0.99
R7085:Prex2 UTSW 1 11098588 missense possibly damaging 0.73
R7101:Prex2 UTSW 1 11153609 missense possibly damaging 0.86
R7106:Prex2 UTSW 1 11136793 missense probably benign 0.33
R7319:Prex2 UTSW 1 11162308 missense probably benign 0.10
R7342:Prex2 UTSW 1 11162325 missense probably benign 0.00
R7469:Prex2 UTSW 1 11285069 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAGCACCTGATCCTAAAGGTTTATCC -3'
(R):5'- AGCTGACACTGAATTGAAGAGCCC -3'

Sequencing Primer
(F):5'- cttgatctttagacaatcctcttacc -3'
(R):5'- CTAAAGCTGCCTGCTTACCT -3'
Posted On2014-04-13