Incidental Mutation 'R1512:Cdc37'
ID168421
Institutional Source Beutler Lab
Gene Symbol Cdc37
Ensembl Gene ENSMUSG00000019471
Gene Namecell division cycle 37
Synonymsp50Cdc37
MMRRC Submission 039559-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.910) question?
Stock #R1512 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location21133222-21149982 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 21142416 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019615] [ENSMUST00000215296]
Predicted Effect probably benign
Transcript: ENSMUST00000019615
SMART Domains Protein: ENSMUSP00000019615
Gene: ENSMUSG00000019471

DomainStartEndE-ValueType
CDC37_N 1 128 1.07e-69 SMART
CDC37_M 121 283 4.37e-84 SMART
CDC37_C 287 379 1.25e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000215296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215866
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency 95% (79/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to Cdc 37, a cell division cycle control protein of Sacchromyces cerevisiae. This protein is a molecular chaperone with specific function in cell signal transduction. It has been shown to form complex with Hsp90 and a variety of protein kinases including CDK4, CDK6, SRC, RAF-1, MOK, as well as eIF2 alpha kinases. It is thought to play a critical role in directing Hsp90 to its target kinases. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,195,469 D40E probably benign Het
Acsf2 C T 11: 94,561,398 probably benign Het
Adamts19 C T 18: 59,048,845 H1119Y possibly damaging Het
Akap6 A G 12: 52,937,154 D827G probably damaging Het
Ankrd33b T C 15: 31,367,229 D55G probably damaging Het
Ano5 T A 7: 51,579,568 H569Q probably benign Het
Aox2 A G 1: 58,307,351 D548G probably benign Het
Baz2a A G 10: 128,124,152 D1433G possibly damaging Het
BC031181 T G 18: 75,008,696 V8G probably damaging Het
Bicdl2 A T 17: 23,668,109 M457L probably damaging Het
C130074G19Rik T C 1: 184,882,906 D29G probably damaging Het
Cd200r1 A T 16: 44,766,027 T7S probably benign Het
Cmtr2 T C 8: 110,222,635 S526P probably damaging Het
Cntn2 G T 1: 132,523,692 A433D probably damaging Het
Cntnap5a T C 1: 115,900,950 S35P probably benign Het
Csf3r A G 4: 126,029,984 T96A possibly damaging Het
Ctbs A G 3: 146,454,965 N96D probably benign Het
Cyp26b1 C A 6: 84,576,997 V213L probably benign Het
Dach1 A G 14: 97,901,399 L536P probably damaging Het
Dcaf6 T C 1: 165,352,020 Q517R probably benign Het
Dnah1 G T 14: 31,293,037 Q1733K probably damaging Het
Dnah17 A T 11: 118,095,015 I1416N probably benign Het
Dock11 G A X: 36,020,035 R1102H probably damaging Het
Dpp8 T C 9: 65,063,814 probably benign Het
Emc1 G A 4: 139,360,184 probably null Het
Emc8 A G 8: 120,658,244 L76P possibly damaging Het
Emx2 T C 19: 59,459,603 Y130H possibly damaging Het
Fbf1 C T 11: 116,147,927 R815Q probably damaging Het
Foxb2 G A 19: 16,872,514 P376L probably damaging Het
Gabrb1 C A 5: 72,108,704 L202I probably damaging Het
Gabrb1 T A 5: 72,108,705 L202Q probably damaging Het
Grin2c T A 11: 115,253,850 I617F probably damaging Het
Gtf2h3 T A 5: 124,590,870 V164E probably damaging Het
Gusb T C 5: 130,000,890 Q88R probably damaging Het
Hormad2 T A 11: 4,424,788 K75N probably damaging Het
Il33 A G 19: 29,951,990 T38A possibly damaging Het
Ivns1abp A T 1: 151,360,936 Q416L possibly damaging Het
Ivns1abp G C 1: 151,360,937 Q416H probably benign Het
Kcnh5 T A 12: 75,119,937 H178L probably benign Het
Kif21b A G 1: 136,152,805 N579S probably benign Het
Kif26a G C 12: 112,146,955 R95P possibly damaging Het
Kl A G 5: 150,988,597 I604V probably benign Het
Klhl24 A G 16: 20,122,936 K545E probably damaging Het
Mcm3ap A G 10: 76,470,513 I153M probably damaging Het
Meis1 T G 11: 18,881,682 D452A probably damaging Het
Msantd4 C T 9: 4,384,138 P153L probably benign Het
Myot A G 18: 44,342,355 E181G probably damaging Het
Nf1 T C 11: 79,390,369 F150S probably damaging Het
Nyap2 T A 1: 81,241,851 S529R probably damaging Het
Olfr1145 A T 2: 87,810,644 T275S probably benign Het
Olfr1386 A G 11: 49,470,459 I103V probably benign Het
Olfr923 T A 9: 38,828,364 Y224* probably null Het
Olfr958 T C 9: 39,550,094 Y259C probably damaging Het
Pcnt C T 10: 76,404,662 probably null Het
Pik3c3 T C 18: 30,322,236 probably null Het
Pkdcc A T 17: 83,220,044 Y217F possibly damaging Het
Pnpla6 C A 8: 3,535,459 probably benign Het
Polr3gl T C 3: 96,580,874 M26V probably benign Het
Ppp1r13b T C 12: 111,872,408 N12S possibly damaging Het
Ppp1r26 G A 2: 28,451,516 R386K probably benign Het
Prdm10 A G 9: 31,337,401 E355G probably damaging Het
Prex2 T C 1: 11,061,330 F41S possibly damaging Het
Prkar1b G T 5: 139,050,673 Y231* probably null Het
Prkdc A T 16: 15,687,404 I857L probably benign Het
Psg21 A T 7: 18,656,500 N10K probably benign Het
Rapgef3 A T 15: 97,757,501 V444E probably benign Het
Rnf17 A T 14: 56,467,786 T716S probably benign Het
Rps6ka1 C T 4: 133,851,004 R577H probably damaging Het
Scn1a A C 2: 66,331,285 N306K possibly damaging Het
Skint6 A G 4: 113,238,132 I110T probably damaging Het
Ssu2 A G 6: 112,387,998 M1T probably null Het
Stag3 A T 5: 138,297,985 T437S probably benign Het
Tal2 A G 4: 53,786,107 Y96C probably benign Het
Thoc3 A T 13: 54,466,178 probably null Het
Tle1 T C 4: 72,141,258 D19G probably damaging Het
Trpm4 A G 7: 45,315,044 I690T probably benign Het
Trpm6 A T 19: 18,875,931 M1772L probably benign Het
Unc5b G A 10: 60,831,475 probably benign Het
Usf3 G T 16: 44,221,198 V2014F probably damaging Het
Utp18 C T 11: 93,885,564 A32T probably benign Het
Wdfy4 A G 14: 32,960,808 V2981A probably damaging Het
Zfp608 A G 18: 54,946,666 V349A probably damaging Het
Znfx1 A C 2: 167,056,317 I229S probably benign Het
Other mutations in Cdc37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01943:Cdc37 APN 9 21143113 missense probably benign 0.00
IGL02448:Cdc37 APN 9 21139851 missense possibly damaging 0.55
IGL02547:Cdc37 APN 9 21139966 unclassified probably benign
R0137:Cdc37 UTSW 9 21142130 missense possibly damaging 0.74
R0195:Cdc37 UTSW 9 21142280 missense probably benign 0.01
R0523:Cdc37 UTSW 9 21142996 missense probably damaging 1.00
R0611:Cdc37 UTSW 9 21142241 missense probably damaging 1.00
R0629:Cdc37 UTSW 9 21140768 missense possibly damaging 0.72
R0755:Cdc37 UTSW 9 21139864 missense probably damaging 1.00
R2127:Cdc37 UTSW 9 21149847 missense probably damaging 1.00
R2238:Cdc37 UTSW 9 21142533 nonsense probably null
R2239:Cdc37 UTSW 9 21142533 nonsense probably null
R3031:Cdc37 UTSW 9 21143191 missense possibly damaging 0.88
R5068:Cdc37 UTSW 9 21149803 missense probably damaging 0.98
R5169:Cdc37 UTSW 9 21141117 missense probably benign 0.00
R5308:Cdc37 UTSW 9 21140764 missense probably benign 0.00
R5333:Cdc37 UTSW 9 21143161 missense possibly damaging 0.69
R5595:Cdc37 UTSW 9 21143213 missense probably damaging 1.00
R7040:Cdc37 UTSW 9 21142223 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCAGGTAGTTGGCCGTTTCCTC -3'
(R):5'- TTGATGCACTTAGCGACGCCAC -3'

Sequencing Primer
(F):5'- TCACACACCAGGTGGACG -3'
(R):5'- CTCCGATGTGGACAGGATG -3'
Posted On2014-04-13