Incidental Mutation 'R1512:Prdm10'
ID168422
Institutional Source Beutler Lab
Gene Symbol Prdm10
Ensembl Gene ENSMUSG00000042496
Gene NamePR domain containing 10
Synonymstristanin, LOC382066
MMRRC Submission 039559-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.881) question?
Stock #R1512 (G1)
Quality Score216
Status Validated
Chromosome9
Chromosomal Location31280538-31381723 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31337401 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 355 (E355G)
Ref Sequence ENSEMBL: ENSMUSP00000149526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074510] [ENSMUST00000215499] [ENSMUST00000215847]
Predicted Effect probably damaging
Transcript: ENSMUST00000074510
AA Change: E324G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074104
Gene: ENSMUSG00000042496
AA Change: E324G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 111 117 N/A INTRINSIC
PDB:3IHX|D 133 284 1e-104 PDB
Blast:SET 165 277 3e-32 BLAST
ZnF_C2H2 300 322 5.42e-2 SMART
Pfam:Tristanin_u2 325 455 2.4e-49 PFAM
ZnF_C2H2 471 493 7.78e-3 SMART
ZnF_C2H2 501 523 1.95e-3 SMART
ZnF_C2H2 529 551 3.83e-2 SMART
ZnF_C2H2 557 580 8.34e-3 SMART
ZnF_C2H2 585 607 3.21e-4 SMART
ZnF_C2H2 613 636 3.69e-4 SMART
ZnF_C2H2 668 691 8.22e-2 SMART
ZnF_C2H2 801 824 1.25e-1 SMART
low complexity region 904 916 N/A INTRINSIC
low complexity region 956 964 N/A INTRINSIC
low complexity region 988 1007 N/A INTRINSIC
low complexity region 1110 1122 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215499
AA Change: E355G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215847
AA Change: E373G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.242 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency 95% (79/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that contains C2H2-type zinc-fingers. It also contains a positive regulatory domain, which has been found in several other zinc-finger transcription factors including those involved in B cell differentiation and tumor suppression. Studies of the mouse counterpart suggest that this protein may be involved in the development of the central nerve system (CNS), as well as in the pathogenesis of neuronal storage disease. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,195,469 D40E probably benign Het
Acsf2 C T 11: 94,561,398 probably benign Het
Adamts19 C T 18: 59,048,845 H1119Y possibly damaging Het
Akap6 A G 12: 52,937,154 D827G probably damaging Het
Ankrd33b T C 15: 31,367,229 D55G probably damaging Het
Ano5 T A 7: 51,579,568 H569Q probably benign Het
Aox2 A G 1: 58,307,351 D548G probably benign Het
Baz2a A G 10: 128,124,152 D1433G possibly damaging Het
BC031181 T G 18: 75,008,696 V8G probably damaging Het
Bicdl2 A T 17: 23,668,109 M457L probably damaging Het
C130074G19Rik T C 1: 184,882,906 D29G probably damaging Het
Cd200r1 A T 16: 44,766,027 T7S probably benign Het
Cdc37 A G 9: 21,142,416 probably benign Het
Cmtr2 T C 8: 110,222,635 S526P probably damaging Het
Cntn2 G T 1: 132,523,692 A433D probably damaging Het
Cntnap5a T C 1: 115,900,950 S35P probably benign Het
Csf3r A G 4: 126,029,984 T96A possibly damaging Het
Ctbs A G 3: 146,454,965 N96D probably benign Het
Cyp26b1 C A 6: 84,576,997 V213L probably benign Het
Dach1 A G 14: 97,901,399 L536P probably damaging Het
Dcaf6 T C 1: 165,352,020 Q517R probably benign Het
Dnah1 G T 14: 31,293,037 Q1733K probably damaging Het
Dnah17 A T 11: 118,095,015 I1416N probably benign Het
Dock11 G A X: 36,020,035 R1102H probably damaging Het
Dpp8 T C 9: 65,063,814 probably benign Het
Emc1 G A 4: 139,360,184 probably null Het
Emc8 A G 8: 120,658,244 L76P possibly damaging Het
Emx2 T C 19: 59,459,603 Y130H possibly damaging Het
Fbf1 C T 11: 116,147,927 R815Q probably damaging Het
Foxb2 G A 19: 16,872,514 P376L probably damaging Het
Gabrb1 C A 5: 72,108,704 L202I probably damaging Het
Gabrb1 T A 5: 72,108,705 L202Q probably damaging Het
Grin2c T A 11: 115,253,850 I617F probably damaging Het
Gtf2h3 T A 5: 124,590,870 V164E probably damaging Het
Gusb T C 5: 130,000,890 Q88R probably damaging Het
Hormad2 T A 11: 4,424,788 K75N probably damaging Het
Il33 A G 19: 29,951,990 T38A possibly damaging Het
Ivns1abp A T 1: 151,360,936 Q416L possibly damaging Het
Ivns1abp G C 1: 151,360,937 Q416H probably benign Het
Kcnh5 T A 12: 75,119,937 H178L probably benign Het
Kif21b A G 1: 136,152,805 N579S probably benign Het
Kif26a G C 12: 112,146,955 R95P possibly damaging Het
Kl A G 5: 150,988,597 I604V probably benign Het
Klhl24 A G 16: 20,122,936 K545E probably damaging Het
Mcm3ap A G 10: 76,470,513 I153M probably damaging Het
Meis1 T G 11: 18,881,682 D452A probably damaging Het
Msantd4 C T 9: 4,384,138 P153L probably benign Het
Myot A G 18: 44,342,355 E181G probably damaging Het
Nf1 T C 11: 79,390,369 F150S probably damaging Het
Nyap2 T A 1: 81,241,851 S529R probably damaging Het
Olfr1145 A T 2: 87,810,644 T275S probably benign Het
Olfr1386 A G 11: 49,470,459 I103V probably benign Het
Olfr923 T A 9: 38,828,364 Y224* probably null Het
Olfr958 T C 9: 39,550,094 Y259C probably damaging Het
Pcnt C T 10: 76,404,662 probably null Het
Pik3c3 T C 18: 30,322,236 probably null Het
Pkdcc A T 17: 83,220,044 Y217F possibly damaging Het
Pnpla6 C A 8: 3,535,459 probably benign Het
Polr3gl T C 3: 96,580,874 M26V probably benign Het
Ppp1r13b T C 12: 111,872,408 N12S possibly damaging Het
Ppp1r26 G A 2: 28,451,516 R386K probably benign Het
Prex2 T C 1: 11,061,330 F41S possibly damaging Het
Prkar1b G T 5: 139,050,673 Y231* probably null Het
Prkdc A T 16: 15,687,404 I857L probably benign Het
Psg21 A T 7: 18,656,500 N10K probably benign Het
Rapgef3 A T 15: 97,757,501 V444E probably benign Het
Rnf17 A T 14: 56,467,786 T716S probably benign Het
Rps6ka1 C T 4: 133,851,004 R577H probably damaging Het
Scn1a A C 2: 66,331,285 N306K possibly damaging Het
Skint6 A G 4: 113,238,132 I110T probably damaging Het
Ssu2 A G 6: 112,387,998 M1T probably null Het
Stag3 A T 5: 138,297,985 T437S probably benign Het
Tal2 A G 4: 53,786,107 Y96C probably benign Het
Thoc3 A T 13: 54,466,178 probably null Het
Tle1 T C 4: 72,141,258 D19G probably damaging Het
Trpm4 A G 7: 45,315,044 I690T probably benign Het
Trpm6 A T 19: 18,875,931 M1772L probably benign Het
Unc5b G A 10: 60,831,475 probably benign Het
Usf3 G T 16: 44,221,198 V2014F probably damaging Het
Utp18 C T 11: 93,885,564 A32T probably benign Het
Wdfy4 A G 14: 32,960,808 V2981A probably damaging Het
Zfp608 A G 18: 54,946,666 V349A probably damaging Het
Znfx1 A C 2: 167,056,317 I229S probably benign Het
Other mutations in Prdm10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Prdm10 APN 9 31360812 splice site probably benign
IGL00485:Prdm10 APN 9 31327546 missense possibly damaging 0.87
IGL00757:Prdm10 APN 9 31318546 missense possibly damaging 0.69
IGL00836:Prdm10 APN 9 31329869 splice site probably benign
IGL01505:Prdm10 APN 9 31327282 missense probably benign
IGL01594:Prdm10 APN 9 31346853 missense probably damaging 1.00
IGL01894:Prdm10 APN 9 31316261 missense probably damaging 1.00
IGL01927:Prdm10 APN 9 31335398 splice site probably benign
IGL02053:Prdm10 APN 9 31360848 missense probably benign 0.00
IGL02068:Prdm10 APN 9 31337350 missense probably damaging 1.00
IGL02295:Prdm10 APN 9 31362368 missense probably benign
IGL02390:Prdm10 APN 9 31353389 missense possibly damaging 0.68
IGL02574:Prdm10 APN 9 31357293 missense probably damaging 1.00
IGL02636:Prdm10 APN 9 31329681 missense possibly damaging 0.68
IGL02883:Prdm10 APN 9 31327348 missense probably damaging 0.99
IGL03057:Prdm10 APN 9 31349185 missense probably damaging 1.00
PIT4142001:Prdm10 UTSW 9 31325767 missense probably benign 0.00
R0089:Prdm10 UTSW 9 31316230 missense probably damaging 1.00
R0149:Prdm10 UTSW 9 31316159 splice site probably benign
R0306:Prdm10 UTSW 9 31316224 missense probably damaging 1.00
R0386:Prdm10 UTSW 9 31316300 missense probably damaging 1.00
R0390:Prdm10 UTSW 9 31349268 critical splice donor site probably null
R1528:Prdm10 UTSW 9 31357286 missense probably damaging 1.00
R2409:Prdm10 UTSW 9 31349122 missense possibly damaging 0.81
R3745:Prdm10 UTSW 9 31340407 missense possibly damaging 0.72
R3929:Prdm10 UTSW 9 31347136 missense probably damaging 1.00
R4295:Prdm10 UTSW 9 31316294 missense possibly damaging 0.94
R4629:Prdm10 UTSW 9 31337316 nonsense probably null
R4660:Prdm10 UTSW 9 31327328 missense probably damaging 1.00
R4758:Prdm10 UTSW 9 31362412 missense probably benign 0.00
R4793:Prdm10 UTSW 9 31353405 missense probably damaging 1.00
R4798:Prdm10 UTSW 9 31341273 missense probably damaging 1.00
R4806:Prdm10 UTSW 9 31329941 makesense probably null
R4865:Prdm10 UTSW 9 31347080 missense probably damaging 1.00
R5068:Prdm10 UTSW 9 31359047 missense probably damaging 0.96
R5093:Prdm10 UTSW 9 31341483 missense probably damaging 1.00
R5162:Prdm10 UTSW 9 31340418 missense possibly damaging 0.90
R5656:Prdm10 UTSW 9 31353417 missense probably benign 0.08
R5855:Prdm10 UTSW 9 31337323 missense probably damaging 1.00
R6242:Prdm10 UTSW 9 31341252 missense possibly damaging 0.67
R6396:Prdm10 UTSW 9 31318546 missense possibly damaging 0.69
R6970:Prdm10 UTSW 9 31329823 nonsense probably null
X0064:Prdm10 UTSW 9 31362451 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTGACCACTGGCTTTTGTTG -3'
(R):5'- GCCTACCTGGTTACCTGTACATGC -3'

Sequencing Primer
(F):5'- TAGCAGCTACTGTCTACAGGG -3'
(R):5'- GTGTGTATGTACAGACACACACAC -3'
Posted On2014-04-13