Incidental Mutation 'R1512:Akap6'
ID168438
Institutional Source Beutler Lab
Gene Symbol Akap6
Ensembl Gene ENSMUSG00000061603
Gene NameA kinase (PRKA) anchor protein 6
Synonyms
MMRRC Submission 039559-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.656) question?
Stock #R1512 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location52699383-53155599 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52937154 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 827 (D827G)
Ref Sequence ENSEMBL: ENSMUSP00000151871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095737] [ENSMUST00000219786]
Predicted Effect probably damaging
Transcript: ENSMUST00000095737
AA Change: D827G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093406
Gene: ENSMUSG00000061603
AA Change: D827G

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
Blast:SPEC 66 168 2e-50 BLAST
low complexity region 441 455 N/A INTRINSIC
low complexity region 544 555 N/A INTRINSIC
low complexity region 569 587 N/A INTRINSIC
low complexity region 640 651 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
SPEC 779 880 1.06e-1 SMART
SPEC 959 1057 1.45e0 SMART
SPEC 1078 1185 2.56e-2 SMART
low complexity region 1316 1332 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1610 1622 N/A INTRINSIC
low complexity region 1683 1698 N/A INTRINSIC
low complexity region 1737 1781 N/A INTRINSIC
low complexity region 1899 1910 N/A INTRINSIC
low complexity region 2019 2031 N/A INTRINSIC
low complexity region 2104 2115 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000219786
AA Change: D827G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.358 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency 95% (79/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is highly expressed in various brain regions and cardiac and skeletal muscle. It is specifically localized to the sarcoplasmic reticulum and nuclear membrane, and is involved in anchoring PKA to the nuclear membrane or sarcoplasmic reticulum. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in partial embryonic lethality; surviving homozygotes display a decreased body weight, craniofacial defects and reduced viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,195,469 D40E probably benign Het
Acsf2 C T 11: 94,561,398 probably benign Het
Adamts19 C T 18: 59,048,845 H1119Y possibly damaging Het
Ankrd33b T C 15: 31,367,229 D55G probably damaging Het
Ano5 T A 7: 51,579,568 H569Q probably benign Het
Aox2 A G 1: 58,307,351 D548G probably benign Het
Baz2a A G 10: 128,124,152 D1433G possibly damaging Het
BC031181 T G 18: 75,008,696 V8G probably damaging Het
Bicdl2 A T 17: 23,668,109 M457L probably damaging Het
C130074G19Rik T C 1: 184,882,906 D29G probably damaging Het
Cd200r1 A T 16: 44,766,027 T7S probably benign Het
Cdc37 A G 9: 21,142,416 probably benign Het
Cmtr2 T C 8: 110,222,635 S526P probably damaging Het
Cntn2 G T 1: 132,523,692 A433D probably damaging Het
Cntnap5a T C 1: 115,900,950 S35P probably benign Het
Csf3r A G 4: 126,029,984 T96A possibly damaging Het
Ctbs A G 3: 146,454,965 N96D probably benign Het
Cyp26b1 C A 6: 84,576,997 V213L probably benign Het
Dach1 A G 14: 97,901,399 L536P probably damaging Het
Dcaf6 T C 1: 165,352,020 Q517R probably benign Het
Dnah1 G T 14: 31,293,037 Q1733K probably damaging Het
Dnah17 A T 11: 118,095,015 I1416N probably benign Het
Dock11 G A X: 36,020,035 R1102H probably damaging Het
Dpp8 T C 9: 65,063,814 probably benign Het
Emc1 G A 4: 139,360,184 probably null Het
Emc8 A G 8: 120,658,244 L76P possibly damaging Het
Emx2 T C 19: 59,459,603 Y130H possibly damaging Het
Fbf1 C T 11: 116,147,927 R815Q probably damaging Het
Foxb2 G A 19: 16,872,514 P376L probably damaging Het
Gabrb1 C A 5: 72,108,704 L202I probably damaging Het
Gabrb1 T A 5: 72,108,705 L202Q probably damaging Het
Grin2c T A 11: 115,253,850 I617F probably damaging Het
Gtf2h3 T A 5: 124,590,870 V164E probably damaging Het
Gusb T C 5: 130,000,890 Q88R probably damaging Het
Hormad2 T A 11: 4,424,788 K75N probably damaging Het
Il33 A G 19: 29,951,990 T38A possibly damaging Het
Ivns1abp A T 1: 151,360,936 Q416L possibly damaging Het
Ivns1abp G C 1: 151,360,937 Q416H probably benign Het
Kcnh5 T A 12: 75,119,937 H178L probably benign Het
Kif21b A G 1: 136,152,805 N579S probably benign Het
Kif26a G C 12: 112,146,955 R95P possibly damaging Het
Kl A G 5: 150,988,597 I604V probably benign Het
Klhl24 A G 16: 20,122,936 K545E probably damaging Het
Mcm3ap A G 10: 76,470,513 I153M probably damaging Het
Meis1 T G 11: 18,881,682 D452A probably damaging Het
Msantd4 C T 9: 4,384,138 P153L probably benign Het
Myot A G 18: 44,342,355 E181G probably damaging Het
Nf1 T C 11: 79,390,369 F150S probably damaging Het
Nyap2 T A 1: 81,241,851 S529R probably damaging Het
Olfr1145 A T 2: 87,810,644 T275S probably benign Het
Olfr1386 A G 11: 49,470,459 I103V probably benign Het
Olfr923 T A 9: 38,828,364 Y224* probably null Het
Olfr958 T C 9: 39,550,094 Y259C probably damaging Het
Pcnt C T 10: 76,404,662 probably null Het
Pik3c3 T C 18: 30,322,236 probably null Het
Pkdcc A T 17: 83,220,044 Y217F possibly damaging Het
Pnpla6 C A 8: 3,535,459 probably benign Het
Polr3gl T C 3: 96,580,874 M26V probably benign Het
Ppp1r13b T C 12: 111,872,408 N12S possibly damaging Het
Ppp1r26 G A 2: 28,451,516 R386K probably benign Het
Prdm10 A G 9: 31,337,401 E355G probably damaging Het
Prex2 T C 1: 11,061,330 F41S possibly damaging Het
Prkar1b G T 5: 139,050,673 Y231* probably null Het
Prkdc A T 16: 15,687,404 I857L probably benign Het
Psg21 A T 7: 18,656,500 N10K probably benign Het
Rapgef3 A T 15: 97,757,501 V444E probably benign Het
Rnf17 A T 14: 56,467,786 T716S probably benign Het
Rps6ka1 C T 4: 133,851,004 R577H probably damaging Het
Scn1a A C 2: 66,331,285 N306K possibly damaging Het
Skint6 A G 4: 113,238,132 I110T probably damaging Het
Ssu2 A G 6: 112,387,998 M1T probably null Het
Stag3 A T 5: 138,297,985 T437S probably benign Het
Tal2 A G 4: 53,786,107 Y96C probably benign Het
Thoc3 A T 13: 54,466,178 probably null Het
Tle1 T C 4: 72,141,258 D19G probably damaging Het
Trpm4 A G 7: 45,315,044 I690T probably benign Het
Trpm6 A T 19: 18,875,931 M1772L probably benign Het
Unc5b G A 10: 60,831,475 probably benign Het
Usf3 G T 16: 44,221,198 V2014F probably damaging Het
Utp18 C T 11: 93,885,564 A32T probably benign Het
Wdfy4 A G 14: 32,960,808 V2981A probably damaging Het
Zfp608 A G 18: 54,946,666 V349A probably damaging Het
Znfx1 A C 2: 167,056,317 I229S probably benign Het
Other mutations in Akap6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Akap6 APN 12 53140980 missense possibly damaging 0.79
IGL00505:Akap6 APN 12 52887102 missense possibly damaging 0.92
IGL01134:Akap6 APN 12 52937217 missense probably damaging 0.96
IGL01458:Akap6 APN 12 52886818 nonsense probably null
IGL01589:Akap6 APN 12 53139664 missense probably damaging 1.00
IGL01592:Akap6 APN 12 53142142 missense probably damaging 1.00
IGL01738:Akap6 APN 12 52886817 missense probably damaging 0.99
IGL01867:Akap6 APN 12 52888008 missense probably damaging 1.00
IGL02025:Akap6 APN 12 53140335 missense probably benign
IGL02041:Akap6 APN 12 53140653 missense probably damaging 1.00
IGL02058:Akap6 APN 12 53140555 missense probably damaging 1.00
IGL02194:Akap6 APN 12 52886823 missense probably benign 0.00
IGL02226:Akap6 APN 12 53010467 splice site probably benign
IGL02323:Akap6 APN 12 53140429 missense probably benign 0.00
IGL02449:Akap6 APN 12 53140188 missense probably damaging 1.00
IGL02475:Akap6 APN 12 53139494 missense probably benign 0.03
IGL02546:Akap6 APN 12 52880738 missense probably damaging 1.00
IGL02547:Akap6 APN 12 53140696 missense probably damaging 1.00
IGL02588:Akap6 APN 12 52886499 nonsense probably null
IGL02608:Akap6 APN 12 53010606 missense probably benign 0.39
IGL02884:Akap6 APN 12 52886622 missense probably benign 0.00
IGL02945:Akap6 APN 12 52880837 missense probably damaging 1.00
IGL03029:Akap6 APN 12 52886412 missense probably damaging 1.00
IGL03129:Akap6 APN 12 53140306 missense probably damaging 1.00
R0133:Akap6 UTSW 12 53139471 nonsense probably null
R0166:Akap6 UTSW 12 53140924 missense probably benign 0.04
R0189:Akap6 UTSW 12 53141254 missense probably benign 0.41
R0532:Akap6 UTSW 12 52887983 missense probably benign 0.00
R0632:Akap6 UTSW 12 52937148 missense probably damaging 1.00
R0666:Akap6 UTSW 12 52911808 missense probably damaging 1.00
R0723:Akap6 UTSW 12 53141902 missense probably damaging 1.00
R0763:Akap6 UTSW 12 53142214 missense possibly damaging 0.93
R0785:Akap6 UTSW 12 52886622 missense probably benign 0.00
R0879:Akap6 UTSW 12 52880799 missense probably damaging 1.00
R0880:Akap6 UTSW 12 53139508 missense possibly damaging 0.93
R1033:Akap6 UTSW 12 53069222 missense probably damaging 0.97
R1055:Akap6 UTSW 12 52880672 nonsense probably null
R1199:Akap6 UTSW 12 52796190 missense probably damaging 1.00
R1295:Akap6 UTSW 12 52887029 missense probably damaging 1.00
R1389:Akap6 UTSW 12 53139520 missense probably benign 0.15
R1471:Akap6 UTSW 12 53141496 missense probably benign 0.05
R1483:Akap6 UTSW 12 52796087 missense probably damaging 1.00
R1648:Akap6 UTSW 12 53142006 nonsense probably null
R1791:Akap6 UTSW 12 53069125 missense probably damaging 1.00
R1888:Akap6 UTSW 12 53142175 missense possibly damaging 0.88
R1888:Akap6 UTSW 12 53142175 missense possibly damaging 0.88
R1891:Akap6 UTSW 12 53142175 missense possibly damaging 0.88
R1899:Akap6 UTSW 12 53141852 missense possibly damaging 0.95
R1917:Akap6 UTSW 12 53104612 missense probably benign 0.13
R1970:Akap6 UTSW 12 52938475 missense probably damaging 0.96
R1987:Akap6 UTSW 12 53140795 missense possibly damaging 0.78
R1988:Akap6 UTSW 12 53140795 missense possibly damaging 0.78
R2153:Akap6 UTSW 12 53141404 missense probably benign 0.03
R2567:Akap6 UTSW 12 52938373 missense probably damaging 1.00
R2568:Akap6 UTSW 12 52887278 missense possibly damaging 0.77
R3025:Akap6 UTSW 12 53140143 missense probably benign
R3051:Akap6 UTSW 12 52887033 missense probably damaging 1.00
R3195:Akap6 UTSW 12 53072457 nonsense probably null
R3196:Akap6 UTSW 12 53072457 nonsense probably null
R3426:Akap6 UTSW 12 52888034 missense probably damaging 1.00
R3783:Akap6 UTSW 12 52880769 missense probably damaging 1.00
R3934:Akap6 UTSW 12 53140444 missense possibly damaging 0.92
R3936:Akap6 UTSW 12 53140444 missense possibly damaging 0.92
R3967:Akap6 UTSW 12 53141453 missense probably damaging 1.00
R3970:Akap6 UTSW 12 53141453 missense probably damaging 1.00
R4042:Akap6 UTSW 12 53139379 critical splice acceptor site probably null
R4095:Akap6 UTSW 12 53139462 missense probably damaging 1.00
R4152:Akap6 UTSW 12 53140407 missense probably benign 0.45
R4231:Akap6 UTSW 12 53141038 missense probably damaging 1.00
R4232:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4233:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4234:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4235:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4236:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4475:Akap6 UTSW 12 53141643 missense probably benign 0.00
R4513:Akap6 UTSW 12 52796004 missense probably benign 0.03
R4686:Akap6 UTSW 12 52887623 frame shift probably null
R4724:Akap6 UTSW 12 52795885 missense possibly damaging 0.80
R4782:Akap6 UTSW 12 52887623 frame shift probably null
R4852:Akap6 UTSW 12 53104675 missense probably damaging 1.00
R5024:Akap6 UTSW 12 53142562 missense probably benign 0.01
R5116:Akap6 UTSW 12 53141515 missense probably benign 0.01
R5164:Akap6 UTSW 12 53142466 missense probably benign
R5225:Akap6 UTSW 12 52886546 missense probably damaging 1.00
R5269:Akap6 UTSW 12 53139843 missense probably damaging 0.99
R5352:Akap6 UTSW 12 52796097 missense probably damaging 1.00
R5496:Akap6 UTSW 12 53140653 missense possibly damaging 0.87
R5551:Akap6 UTSW 12 52795964 missense probably damaging 1.00
R5997:Akap6 UTSW 12 52937233 critical splice donor site probably null
R6137:Akap6 UTSW 12 53140354 missense probably damaging 1.00
R6151:Akap6 UTSW 12 53025792 missense probably damaging 1.00
R6169:Akap6 UTSW 12 53142358 missense probably benign
R6307:Akap6 UTSW 12 53141568 missense possibly damaging 0.85
R6351:Akap6 UTSW 12 53142025 missense probably damaging 0.98
R6479:Akap6 UTSW 12 53141169 missense probably damaging 1.00
R6502:Akap6 UTSW 12 53140215 missense probably damaging 1.00
R6760:Akap6 UTSW 12 53139778 missense probably damaging 1.00
R6778:Akap6 UTSW 12 53025816 missense probably damaging 1.00
R6837:Akap6 UTSW 12 53141262 missense probably damaging 1.00
R6896:Akap6 UTSW 12 52887494 missense probably benign 0.06
R6917:Akap6 UTSW 12 53069168 missense probably null 0.97
R6983:Akap6 UTSW 12 52887653 missense probably damaging 1.00
X0062:Akap6 UTSW 12 53142361 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- CGAGCAGTTTCCAAACAGATGCAC -3'
(R):5'- CGGATGGCAAGCCCCAAATAAAATG -3'

Sequencing Primer
(F):5'- GATGCACTCTGCTAGTCTAACAG -3'
(R):5'- ACAGACCGTTTGGAGGC -3'
Posted On2014-04-13