Incidental Mutation 'R1512:Rnf17'
ID168446
Institutional Source Beutler Lab
Gene Symbol Rnf17
Ensembl Gene ENSMUSG00000000365
Gene Namering finger protein 17
SynonymsMMIP-2
MMRRC Submission 039559-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.583) question?
Stock #R1512 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location56402581-56525032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 56467786 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 716 (T716S)
Ref Sequence ENSEMBL: ENSMUSP00000093469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095793] [ENSMUST00000223627]
Predicted Effect probably benign
Transcript: ENSMUST00000095793
AA Change: T716S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000093469
Gene: ENSMUSG00000000365
AA Change: T716S

DomainStartEndE-ValueType
Blast:RING 9 72 2e-15 BLAST
low complexity region 398 405 N/A INTRINSIC
Pfam:TUDOR 440 522 8.2e-8 PFAM
TUDOR 750 807 4.32e-12 SMART
low complexity region 824 836 N/A INTRINSIC
Blast:TUDOR 850 882 1e-8 BLAST
low complexity region 959 970 N/A INTRINSIC
TUDOR 984 1042 1.29e-1 SMART
low complexity region 1128 1139 N/A INTRINSIC
TUDOR 1245 1301 7.7e-9 SMART
low complexity region 1416 1430 N/A INTRINSIC
TUDOR 1495 1554 1e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225621
Meta Mutation Damage Score 0.0544 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency 95% (79/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a testis-specific protein containing a RING finger domain. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display male infertility, azoospermia, arrest of spermatogenesis, and small testis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,195,469 D40E probably benign Het
Acsf2 C T 11: 94,561,398 probably benign Het
Adamts19 C T 18: 59,048,845 H1119Y possibly damaging Het
Akap6 A G 12: 52,937,154 D827G probably damaging Het
Ankrd33b T C 15: 31,367,229 D55G probably damaging Het
Ano5 T A 7: 51,579,568 H569Q probably benign Het
Aox2 A G 1: 58,307,351 D548G probably benign Het
Baz2a A G 10: 128,124,152 D1433G possibly damaging Het
BC031181 T G 18: 75,008,696 V8G probably damaging Het
Bicdl2 A T 17: 23,668,109 M457L probably damaging Het
C130074G19Rik T C 1: 184,882,906 D29G probably damaging Het
Cd200r1 A T 16: 44,766,027 T7S probably benign Het
Cdc37 A G 9: 21,142,416 probably benign Het
Cmtr2 T C 8: 110,222,635 S526P probably damaging Het
Cntn2 G T 1: 132,523,692 A433D probably damaging Het
Cntnap5a T C 1: 115,900,950 S35P probably benign Het
Csf3r A G 4: 126,029,984 T96A possibly damaging Het
Ctbs A G 3: 146,454,965 N96D probably benign Het
Cyp26b1 C A 6: 84,576,997 V213L probably benign Het
Dach1 A G 14: 97,901,399 L536P probably damaging Het
Dcaf6 T C 1: 165,352,020 Q517R probably benign Het
Dnah1 G T 14: 31,293,037 Q1733K probably damaging Het
Dnah17 A T 11: 118,095,015 I1416N probably benign Het
Dock11 G A X: 36,020,035 R1102H probably damaging Het
Dpp8 T C 9: 65,063,814 probably benign Het
Emc1 G A 4: 139,360,184 probably null Het
Emc8 A G 8: 120,658,244 L76P possibly damaging Het
Emx2 T C 19: 59,459,603 Y130H possibly damaging Het
Fbf1 C T 11: 116,147,927 R815Q probably damaging Het
Foxb2 G A 19: 16,872,514 P376L probably damaging Het
Gabrb1 C A 5: 72,108,704 L202I probably damaging Het
Gabrb1 T A 5: 72,108,705 L202Q probably damaging Het
Grin2c T A 11: 115,253,850 I617F probably damaging Het
Gtf2h3 T A 5: 124,590,870 V164E probably damaging Het
Gusb T C 5: 130,000,890 Q88R probably damaging Het
Hormad2 T A 11: 4,424,788 K75N probably damaging Het
Il33 A G 19: 29,951,990 T38A possibly damaging Het
Ivns1abp A T 1: 151,360,936 Q416L possibly damaging Het
Ivns1abp G C 1: 151,360,937 Q416H probably benign Het
Kcnh5 T A 12: 75,119,937 H178L probably benign Het
Kif21b A G 1: 136,152,805 N579S probably benign Het
Kif26a G C 12: 112,146,955 R95P possibly damaging Het
Kl A G 5: 150,988,597 I604V probably benign Het
Klhl24 A G 16: 20,122,936 K545E probably damaging Het
Mcm3ap A G 10: 76,470,513 I153M probably damaging Het
Meis1 T G 11: 18,881,682 D452A probably damaging Het
Msantd4 C T 9: 4,384,138 P153L probably benign Het
Myot A G 18: 44,342,355 E181G probably damaging Het
Nf1 T C 11: 79,390,369 F150S probably damaging Het
Nyap2 T A 1: 81,241,851 S529R probably damaging Het
Olfr1145 A T 2: 87,810,644 T275S probably benign Het
Olfr1386 A G 11: 49,470,459 I103V probably benign Het
Olfr923 T A 9: 38,828,364 Y224* probably null Het
Olfr958 T C 9: 39,550,094 Y259C probably damaging Het
Pcnt C T 10: 76,404,662 probably null Het
Pik3c3 T C 18: 30,322,236 probably null Het
Pkdcc A T 17: 83,220,044 Y217F possibly damaging Het
Pnpla6 C A 8: 3,535,459 probably benign Het
Polr3gl T C 3: 96,580,874 M26V probably benign Het
Ppp1r13b T C 12: 111,872,408 N12S possibly damaging Het
Ppp1r26 G A 2: 28,451,516 R386K probably benign Het
Prdm10 A G 9: 31,337,401 E355G probably damaging Het
Prex2 T C 1: 11,061,330 F41S possibly damaging Het
Prkar1b G T 5: 139,050,673 Y231* probably null Het
Prkdc A T 16: 15,687,404 I857L probably benign Het
Psg21 A T 7: 18,656,500 N10K probably benign Het
Rapgef3 A T 15: 97,757,501 V444E probably benign Het
Rps6ka1 C T 4: 133,851,004 R577H probably damaging Het
Scn1a A C 2: 66,331,285 N306K possibly damaging Het
Skint6 A G 4: 113,238,132 I110T probably damaging Het
Ssu2 A G 6: 112,387,998 M1T probably null Het
Stag3 A T 5: 138,297,985 T437S probably benign Het
Tal2 A G 4: 53,786,107 Y96C probably benign Het
Thoc3 A T 13: 54,466,178 probably null Het
Tle1 T C 4: 72,141,258 D19G probably damaging Het
Trpm4 A G 7: 45,315,044 I690T probably benign Het
Trpm6 A T 19: 18,875,931 M1772L probably benign Het
Unc5b G A 10: 60,831,475 probably benign Het
Usf3 G T 16: 44,221,198 V2014F probably damaging Het
Utp18 C T 11: 93,885,564 A32T probably benign Het
Wdfy4 A G 14: 32,960,808 V2981A probably damaging Het
Zfp608 A G 18: 54,946,666 V349A probably damaging Het
Znfx1 A C 2: 167,056,317 I229S probably benign Het
Other mutations in Rnf17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Rnf17 APN 14 56421082 missense probably damaging 0.99
IGL00717:Rnf17 APN 14 56465750 missense probably benign 0.00
IGL00978:Rnf17 APN 14 56512271 missense probably damaging 1.00
IGL01295:Rnf17 APN 14 56463064 nonsense probably null
IGL01779:Rnf17 APN 14 56462063 missense probably benign 0.06
IGL02132:Rnf17 APN 14 56421166 missense probably benign 0.27
IGL02183:Rnf17 APN 14 56507868 missense probably null 0.99
IGL02387:Rnf17 APN 14 56500587 missense probably damaging 1.00
IGL02422:Rnf17 APN 14 56482135 missense probably damaging 1.00
IGL03081:Rnf17 APN 14 56434371 missense probably benign 0.03
IGL03269:Rnf17 APN 14 56427946 missense possibly damaging 0.74
R0046:Rnf17 UTSW 14 56471373 missense probably damaging 1.00
R0046:Rnf17 UTSW 14 56471373 missense probably damaging 1.00
R0089:Rnf17 UTSW 14 56514106 missense probably damaging 1.00
R0189:Rnf17 UTSW 14 56482193 missense probably null 1.00
R0243:Rnf17 UTSW 14 56482084 missense possibly damaging 0.80
R0245:Rnf17 UTSW 14 56438609 missense probably damaging 0.97
R0486:Rnf17 UTSW 14 56514175 missense probably benign 0.43
R0554:Rnf17 UTSW 14 56522550 missense probably damaging 1.00
R0840:Rnf17 UTSW 14 56475447 missense probably damaging 1.00
R1169:Rnf17 UTSW 14 56514165 missense possibly damaging 0.89
R1170:Rnf17 UTSW 14 56425631 missense probably benign 0.10
R1200:Rnf17 UTSW 14 56467706 missense probably benign 0.44
R1464:Rnf17 UTSW 14 56461911 missense probably damaging 1.00
R1464:Rnf17 UTSW 14 56461911 missense probably damaging 1.00
R1472:Rnf17 UTSW 14 56427979 missense probably damaging 1.00
R1605:Rnf17 UTSW 14 56493365 missense probably damaging 1.00
R1778:Rnf17 UTSW 14 56522399 missense probably damaging 0.99
R1791:Rnf17 UTSW 14 56504007 nonsense probably null
R2015:Rnf17 UTSW 14 56486969 missense probably benign 0.00
R2023:Rnf17 UTSW 14 56431579 missense possibly damaging 0.59
R2086:Rnf17 UTSW 14 56483380 missense probably damaging 0.98
R2130:Rnf17 UTSW 14 56493354 missense probably damaging 1.00
R2309:Rnf17 UTSW 14 56505982 missense possibly damaging 0.95
R3003:Rnf17 UTSW 14 56500547 missense probably damaging 1.00
R3611:Rnf17 UTSW 14 56467740 missense probably benign 0.43
R3847:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3848:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3849:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3850:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3872:Rnf17 UTSW 14 56475413 missense possibly damaging 0.89
R3874:Rnf17 UTSW 14 56475413 missense possibly damaging 0.89
R4021:Rnf17 UTSW 14 56460001 missense probably damaging 0.98
R4022:Rnf17 UTSW 14 56460001 missense probably damaging 0.98
R4790:Rnf17 UTSW 14 56434355 missense probably damaging 1.00
R4951:Rnf17 UTSW 14 56522391 missense probably benign 0.02
R5068:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5069:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5070:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5518:Rnf17 UTSW 14 56482133 missense probably damaging 1.00
R5628:Rnf17 UTSW 14 56486952 splice site probably null
R5712:Rnf17 UTSW 14 56471399 missense probably benign 0.19
R5747:Rnf17 UTSW 14 56465819 critical splice donor site probably null
R5869:Rnf17 UTSW 14 56505988 missense possibly damaging 0.94
R6336:Rnf17 UTSW 14 56421169 unclassified probably null
R6626:Rnf17 UTSW 14 56427924 missense possibly damaging 0.92
R6639:Rnf17 UTSW 14 56438743 missense probably benign 0.01
R6675:Rnf17 UTSW 14 56459975 missense probably damaging 1.00
R6731:Rnf17 UTSW 14 56524350 missense possibly damaging 0.93
R7062:Rnf17 UTSW 14 56465654 missense probably benign 0.00
R7103:Rnf17 UTSW 14 56471306 missense not run
Predicted Primers PCR Primer
(F):5'- ACATGCTTTTGACCAGTCTCAGCTC -3'
(R):5'- TGAGAGACCAATGACAAGCCTGC -3'

Sequencing Primer
(F):5'- AGCTCCAGAGTCCTCTGATAG -3'
(R):5'- GTTGGAATTAGCTTTCCCAGTC -3'
Posted On2014-04-13