Incidental Mutation 'R1513:Kif21b'
ID168469
Institutional Source Beutler Lab
Gene Symbol Kif21b
Ensembl Gene ENSMUSG00000041642
Gene Namekinesin family member 21B
SynonymsN-5 kinesin, 2610511N21Rik
MMRRC Submission 039560-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R1513 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location136131389-136177998 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 136156111 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 699 (Y699H)
Ref Sequence ENSEMBL: ENSMUSP00000114297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075164] [ENSMUST00000130864] [ENSMUST00000171381]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075164
AA Change: Y699H

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074661
Gene: ENSMUSG00000041642
AA Change: Y699H

DomainStartEndE-ValueType
KISc 6 379 6.39e-159 SMART
Blast:KISc 469 543 1e-14 BLAST
low complexity region 578 628 N/A INTRINSIC
coiled coil region 632 825 N/A INTRINSIC
low complexity region 847 866 N/A INTRINSIC
coiled coil region 931 991 N/A INTRINSIC
low complexity region 1109 1123 N/A INTRINSIC
low complexity region 1239 1249 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
WD40 1299 1336 2.89e-5 SMART
WD40 1339 1377 5.69e-4 SMART
WD40 1404 1441 6.42e-1 SMART
WD40 1444 1486 1.5e-3 SMART
WD40 1494 1532 4.8e-2 SMART
WD40 1535 1575 1.55e-5 SMART
WD40 1578 1615 3.81e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130864
AA Change: Y699H

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114297
Gene: ENSMUSG00000041642
AA Change: Y699H

DomainStartEndE-ValueType
KISc 6 379 6.39e-159 SMART
Blast:KISc 469 543 1e-14 BLAST
low complexity region 578 628 N/A INTRINSIC
coiled coil region 632 825 N/A INTRINSIC
low complexity region 847 866 N/A INTRINSIC
coiled coil region 931 991 N/A INTRINSIC
low complexity region 1109 1123 N/A INTRINSIC
low complexity region 1239 1249 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
WD40 1299 1336 2.89e-5 SMART
WD40 1339 1377 5.69e-4 SMART
WD40 1404 1441 6.42e-1 SMART
WD40 1444 1486 1.5e-3 SMART
WD40 1494 1532 4.8e-2 SMART
WD40 1535 1575 1.55e-5 SMART
WD40 1578 1615 5.1e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171381
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin superfamily. Kinesins are ATP-dependent microtubule-based motor proteins that are involved in the intracellular transport of membranous organelles. Single nucleotide polymorphisms in this gene are associated with inflammatory bowel disease and multiple sclerosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous KO reduces dendrite branching and spine density as a result of reduced microtubule growth, resulting in impaired spatial learning and cued conditioning behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500011B03Rik A T 5: 114,809,273 C64* probably null Het
1700003H04Rik A C 3: 124,575,336 Y109D possibly damaging Het
Abca15 A T 7: 120,340,099 I239F probably damaging Het
Adgrv1 A T 13: 81,556,957 I1578K probably damaging Het
Adgrv1 A G 13: 81,593,048 V99A probably damaging Het
Ap4e1 G T 2: 127,061,555 K792N probably null Het
Ap5b1 G A 19: 5,569,864 W437* probably null Het
Arhgef17 A G 7: 100,930,862 L293P probably benign Het
Arhgef33 A C 17: 80,371,389 M505L probably benign Het
Arih1 T A 9: 59,403,380 R320S probably damaging Het
Atp1b3 A T 9: 96,364,153 M1K probably null Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
Bbs2 T C 8: 94,089,844 D130G possibly damaging Het
Bscl2 G A 19: 8,841,145 R38H probably damaging Het
Cad A G 5: 31,068,762 Y1102C probably damaging Het
Cc2d1b G A 4: 108,633,226 R825Q probably damaging Het
Ccdc39 A G 3: 33,839,145 V97A possibly damaging Het
Ccr1 T C 9: 123,964,473 T7A probably benign Het
Cd33 A G 7: 43,532,194 S181P probably damaging Het
Cdc20 A C 4: 118,433,107 S452R probably damaging Het
Cdk8 A T 5: 146,296,378 I229F possibly damaging Het
Ces3a A T 8: 105,050,277 N131Y probably damaging Het
Cgnl1 A G 9: 71,724,590 I493T probably benign Het
Chia1 G A 3: 106,131,904 V437M probably benign Het
Chrna2 G A 14: 66,143,429 R49H probably benign Het
Clec12b A G 6: 129,376,302 C241R probably damaging Het
Col11a1 A G 3: 114,097,154 D380G unknown Het
Crebbp A G 16: 4,115,885 S948P probably damaging Het
Dchs1 G A 7: 105,772,071 R381* probably null Het
Defb19 A T 2: 152,576,165 *84R probably null Het
Dnah8 T C 17: 30,673,888 F816L probably benign Het
Dync2h1 T A 9: 7,103,663 I371F possibly damaging Het
Fggy T C 4: 95,902,058 probably benign Het
Galnt12 G A 4: 47,117,956 C125Y probably damaging Het
Gm4952 A T 19: 12,624,675 D149V probably damaging Het
Gm6309 A T 5: 146,170,583 H37Q possibly damaging Het
Gmnn A G 13: 24,756,632 L78P possibly damaging Het
Golga4 C A 9: 118,555,732 Q613K probably benign Het
Iqgap2 A T 13: 95,630,010 I1495K probably damaging Het
Junb T C 8: 84,978,129 T101A probably damaging Het
Klf17 T C 4: 117,760,935 E75G probably damaging Het
Klra17 T C 6: 129,872,314 E99G possibly damaging Het
Knop1 CTCTTCTTCTTCTTCTTCTTCTTC CTCTTCTTCTTCTTCTTCTTC 7: 118,852,449 probably benign Het
Krt83 C T 15: 101,489,657 V167M probably benign Het
Lce1m A G 3: 93,018,625 probably benign Het
Lpin3 A T 2: 160,904,548 Y709F probably damaging Het
Ltbp2 T A 12: 84,791,944 D1080V probably damaging Het
Mycbp2 G A 14: 103,204,389 T1980I probably damaging Het
Myo1g T A 11: 6,515,140 K435M probably damaging Het
Mypn T A 10: 63,169,368 N320I probably damaging Het
Naip5 A T 13: 100,222,206 W841R probably benign Het
Ncapd2 A T 6: 125,170,992 M1124K probably damaging Het
Ncf4 A G 15: 78,262,360 D330G probably benign Het
Ndst3 C T 3: 123,601,455 V509M possibly damaging Het
Neb A T 2: 52,227,244 D4105E probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nsrp1 A T 11: 77,046,619 F250L probably benign Het
Olfr1024 A T 2: 85,904,671 Y128N probably damaging Het
Olfr1087 C T 2: 86,690,797 M59I possibly damaging Het
Olfr552 G T 7: 102,605,302 G316V probably benign Het
Olfr646 C T 7: 104,106,464 L62F probably benign Het
Olfr724 T C 14: 49,961,101 probably null Het
Olfr740 A G 14: 50,453,681 I210V probably benign Het
Oxr1 A G 15: 41,797,474 D67G probably damaging Het
P2ry12 A T 3: 59,218,077 I59N probably damaging Het
Pcdhb12 G T 18: 37,437,058 G419V probably damaging Het
Pdzd2 G T 15: 12,373,829 S2073R possibly damaging Het
Pex5l C A 3: 33,015,013 E112* probably null Het
Plaur A G 7: 24,472,591 D163G probably benign Het
Plk2 A G 13: 110,400,088 Y638C probably benign Het
Ppp1r15b A G 1: 133,133,350 N535S probably benign Het
Ppp2r1b T C 9: 50,870,145 L21P probably damaging Het
Prkar2a G A 9: 108,728,270 V176I possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rag1 A G 2: 101,642,991 M602T possibly damaging Het
Rb1 A G 14: 73,322,084 V60A probably benign Het
Rgs20 T A 1: 4,912,337 I303F probably damaging Het
Rnf43 T A 11: 87,729,431 I240N probably damaging Het
Romo1 G A 2: 156,144,513 V19M probably benign Het
Ryr1 A G 7: 29,070,621 S2676P probably damaging Het
Ryr3 G A 2: 112,709,197 Q3233* probably null Het
Skiv2l G T 17: 34,847,444 P188T probably damaging Het
Slc26a6 A G 9: 108,855,836 R5G probably benign Het
Slc33a1 A G 3: 63,963,955 L79P probably damaging Het
Snx31 G A 15: 36,545,600 R91C probably damaging Het
Tecpr2 T C 12: 110,954,800 I1269T possibly damaging Het
Tjap1 G T 17: 46,261,442 D89E probably benign Het
Tmem53 A T 4: 117,265,893 Q39L probably damaging Het
Tmod1 G T 4: 46,083,549 V95F possibly damaging Het
Trim30c A C 7: 104,382,689 H306Q probably benign Het
Trpm3 A T 19: 22,986,872 M1244L possibly damaging Het
Tspan32 A G 7: 143,005,149 I14V probably null Het
Ube4b A G 4: 149,351,578 V695A probably benign Het
Ubxn11 G A 4: 134,124,141 probably null Het
Ugt3a2 A G 15: 9,361,524 I129V probably benign Het
Vmn1r45 A G 6: 89,933,076 V304A probably damaging Het
Vmn2r124 A T 17: 18,063,273 S410C probably damaging Het
Vmn2r15 T A 5: 109,293,329 D221V probably damaging Het
Vmn2r79 G A 7: 87,037,444 V678I probably benign Het
Vps13b A T 15: 35,438,730 R319* probably null Het
Wdr95 G A 5: 149,599,294 R639Q probably benign Het
Xirp2 A G 2: 67,511,530 I1372V probably benign Het
Xpo5 T A 17: 46,226,980 M611K probably benign Het
Zfat A G 15: 68,212,680 C121R probably damaging Het
Zfp382 A T 7: 30,133,296 Y124F probably benign Het
Zfp512b A G 2: 181,589,189 F371S probably benign Het
Zfy2 A G Y: 2,116,185 V285A probably benign Het
Other mutations in Kif21b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Kif21b APN 1 136152342 missense possibly damaging 0.68
IGL01020:Kif21b APN 1 136154094 splice site probably benign
IGL01288:Kif21b APN 1 136172184 missense probably benign 0.00
IGL02105:Kif21b APN 1 136171303 missense probably benign
IGL02264:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02303:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02308:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02310:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02419:Kif21b APN 1 136151267 missense probably benign 0.00
IGL02553:Kif21b APN 1 136154121 missense probably damaging 1.00
IGL02568:Kif21b APN 1 136172867 missense probably damaging 0.96
IGL02657:Kif21b APN 1 136172230 missense possibly damaging 0.88
IGL03068:Kif21b APN 1 136158355 unclassified probably benign
IGL03230:Kif21b APN 1 136162812 missense probably benign 0.03
R0190:Kif21b UTSW 1 136171219 missense probably benign 0.32
R0349:Kif21b UTSW 1 136149311 missense probably damaging 0.97
R0501:Kif21b UTSW 1 136163099 missense probably benign 0.44
R0620:Kif21b UTSW 1 136159428 missense possibly damaging 0.88
R0629:Kif21b UTSW 1 136172157 critical splice acceptor site probably null
R0741:Kif21b UTSW 1 136159744 missense probably damaging 1.00
R1087:Kif21b UTSW 1 136162823 missense probably damaging 1.00
R1217:Kif21b UTSW 1 136152376 missense probably damaging 1.00
R1464:Kif21b UTSW 1 136156153 missense possibly damaging 0.50
R1464:Kif21b UTSW 1 136156153 missense possibly damaging 0.50
R1511:Kif21b UTSW 1 136169324 critical splice donor site probably null
R1512:Kif21b UTSW 1 136152805 missense probably benign 0.01
R1591:Kif21b UTSW 1 136149317 missense probably damaging 1.00
R1616:Kif21b UTSW 1 136171685 missense probably damaging 1.00
R1628:Kif21b UTSW 1 136171220 missense probably benign 0.01
R1658:Kif21b UTSW 1 136171285 missense probably damaging 1.00
R1728:Kif21b UTSW 1 136160121 missense possibly damaging 0.85
R1741:Kif21b UTSW 1 136156142 missense probably damaging 1.00
R1784:Kif21b UTSW 1 136160121 missense possibly damaging 0.85
R1807:Kif21b UTSW 1 136147793 missense possibly damaging 0.94
R1896:Kif21b UTSW 1 136147845 missense possibly damaging 0.90
R1970:Kif21b UTSW 1 136171156 missense probably damaging 1.00
R1984:Kif21b UTSW 1 136147546 missense probably damaging 1.00
R1985:Kif21b UTSW 1 136147546 missense probably damaging 1.00
R1986:Kif21b UTSW 1 136147546 missense probably damaging 1.00
R1988:Kif21b UTSW 1 136152264 missense probably damaging 0.98
R1990:Kif21b UTSW 1 136161770 missense probably damaging 1.00
R2014:Kif21b UTSW 1 136148282 missense probably damaging 1.00
R2045:Kif21b UTSW 1 136160313 missense probably damaging 1.00
R2141:Kif21b UTSW 1 136152264 missense probably damaging 0.98
R2248:Kif21b UTSW 1 136172966 missense probably damaging 1.00
R2886:Kif21b UTSW 1 136147874 splice site probably benign
R2896:Kif21b UTSW 1 136154217 missense possibly damaging 0.82
R3706:Kif21b UTSW 1 136159410 missense probably benign 0.06
R3780:Kif21b UTSW 1 136156226 missense probably damaging 0.99
R3827:Kif21b UTSW 1 136162994 critical splice donor site probably null
R4227:Kif21b UTSW 1 136154093 splice site probably null
R4600:Kif21b UTSW 1 136147864 missense probably benign 0.39
R4608:Kif21b UTSW 1 136148186 intron probably benign
R4749:Kif21b UTSW 1 136144749 nonsense probably null
R4841:Kif21b UTSW 1 136145220 missense probably damaging 1.00
R4842:Kif21b UTSW 1 136145220 missense probably damaging 1.00
R4933:Kif21b UTSW 1 136151325 splice site probably null
R4959:Kif21b UTSW 1 136148370 missense possibly damaging 0.90
R5018:Kif21b UTSW 1 136172234 missense probably benign 0.30
R5116:Kif21b UTSW 1 136152783 missense probably damaging 0.99
R5119:Kif21b UTSW 1 136163100 missense probably benign
R5197:Kif21b UTSW 1 136144625 missense probably damaging 1.00
R5230:Kif21b UTSW 1 136171673 missense probably damaging 1.00
R5249:Kif21b UTSW 1 136169228 missense probably damaging 1.00
R5337:Kif21b UTSW 1 136171143 missense probably damaging 1.00
R5358:Kif21b UTSW 1 136172292 missense possibly damaging 0.85
R5466:Kif21b UTSW 1 136147525 missense probably damaging 1.00
R5557:Kif21b UTSW 1 136170059 missense probably damaging 1.00
R5727:Kif21b UTSW 1 136170009 missense probably damaging 1.00
R5865:Kif21b UTSW 1 136151137 nonsense probably null
R5929:Kif21b UTSW 1 136151207 missense probably damaging 1.00
R6274:Kif21b UTSW 1 136149418 missense possibly damaging 0.57
R6349:Kif21b UTSW 1 136158326 missense probably damaging 1.00
R6648:Kif21b UTSW 1 136152397 missense probably benign 0.00
R6831:Kif21b UTSW 1 136144758 nonsense probably null
X0053:Kif21b UTSW 1 136149316 missense probably damaging 1.00
X0066:Kif21b UTSW 1 136172945 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAATCACACCACAGCGGCTC -3'
(R):5'- CTTCAGCTCCCTTTCATAGCGAGAC -3'

Sequencing Primer
(F):5'- agcaggaaagttagggcag -3'
(R):5'- CCTTTCATAGCGAGACTGGTTC -3'
Posted On2014-04-13