Incidental Mutation 'R1513:Cad'
ID168507
Institutional Source Beutler Lab
Gene Symbol Cad
Ensembl Gene ENSMUSG00000013629
Gene Namecarbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
Synonyms
MMRRC Submission 039560-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R1513 (G1)
Quality Score186
Status Not validated
Chromosome5
Chromosomal Location31054780-31078479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31068762 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1102 (Y1102C)
Ref Sequence ENSEMBL: ENSMUSP00000144684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013773] [ENSMUST00000200953] [ENSMUST00000201182] [ENSMUST00000201838] [ENSMUST00000202795]
Predicted Effect probably damaging
Transcript: ENSMUST00000013773
AA Change: Y1102C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000013773
Gene: ENSMUSG00000013629
AA Change: Y1102C

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 4.7e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:ATP-grasp_4 511 692 1.2e-15 PFAM
Pfam:CPSase_L_D2 514 718 1.8e-85 PFAM
Pfam:ATP-grasp 522 690 1.5e-9 PFAM
Pfam:Dala_Dala_lig_C 527 687 2.2e-10 PFAM
CPSase_L_D3 798 921 9.7e-59 SMART
Pfam:ATP-grasp_4 1044 1223 1.8e-23 PFAM
Pfam:CPSase_L_D2 1047 1250 3.1e-28 PFAM
Pfam:Dala_Dala_lig_C 1054 1242 2.3e-7 PFAM
Pfam:ATP-grasp 1055 1222 2.1e-12 PFAM
MGS 1327 1428 1.35e-7 SMART
Pfam:Amidohydro_1 1462 1730 7.4e-12 PFAM
low complexity region 1820 1839 N/A INTRINSIC
low complexity region 1864 1880 N/A INTRINSIC
Pfam:OTCace_N 1924 2065 1.9e-44 PFAM
Pfam:OTCace 2071 2221 7.6e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200953
AA Change: Y1039C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144307
Gene: ENSMUSG00000013629
AA Change: Y1039C

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 4.5e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:CPSase_L_D2 514 616 1.5e-34 PFAM
Pfam:Dala_Dala_lig_C 527 625 2.4e-7 PFAM
Pfam:CPSase_L_D2 614 655 4.9e-15 PFAM
CPSase_L_D3 735 858 9.7e-59 SMART
Pfam:ATP-grasp_4 981 1160 1.7e-23 PFAM
Pfam:CPSase_L_D2 984 1187 3e-28 PFAM
Pfam:Dala_Dala_lig_C 991 1179 2.3e-7 PFAM
Pfam:ATP-grasp 992 1159 2.1e-12 PFAM
MGS 1264 1365 1.35e-7 SMART
Pfam:Amidohydro_1 1399 1667 7.1e-12 PFAM
low complexity region 1757 1776 N/A INTRINSIC
low complexity region 1801 1817 N/A INTRINSIC
Pfam:OTCace_N 1861 2002 1.8e-44 PFAM
Pfam:OTCace 2008 2158 7.3e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000201182
AA Change: Y1102C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144684
Gene: ENSMUSG00000013629
AA Change: Y1102C

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 4.5e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:ATP-grasp_4 511 692 1.1e-15 PFAM
Pfam:CPSase_L_D2 514 718 1.7e-85 PFAM
Pfam:ATP-grasp 522 690 1.4e-9 PFAM
Pfam:Dala_Dala_lig_C 527 687 2.1e-10 PFAM
CPSase_L_D3 798 921 9.7e-59 SMART
Pfam:ATP-grasp_4 1044 1223 1.7e-23 PFAM
Pfam:CPSase_L_D2 1047 1250 3e-28 PFAM
Pfam:Dala_Dala_lig_C 1054 1242 2.3e-7 PFAM
Pfam:ATP-grasp 1055 1222 2.1e-12 PFAM
MGS 1327 1428 1.35e-7 SMART
Pfam:Amidohydro_1 1462 1730 7.1e-12 PFAM
low complexity region 1820 1839 N/A INTRINSIC
low complexity region 1864 1880 N/A INTRINSIC
Pfam:OTCace_N 1949 1994 1.4e-11 PFAM
Pfam:OTCace 2000 2150 7.3e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201256
Predicted Effect probably benign
Transcript: ENSMUST00000201838
SMART Domains Protein: ENSMUSP00000144127
Gene: ENSMUSG00000013629

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 6.3e-48 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:ATP-grasp_4 511 692 1.9e-16 PFAM
Pfam:CPSase_L_D2 514 718 3.7e-86 PFAM
Pfam:ATP-grasp 522 690 2.5e-10 PFAM
Pfam:Dala_Dala_lig_C 526 687 4.2e-11 PFAM
CPSase_L_D3 798 921 9.7e-59 SMART
SCOP:d1a9xa3 935 964 1e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201844
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201870
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202391
Predicted Effect probably damaging
Transcript: ENSMUST00000202795
AA Change: Y1102C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144009
Gene: ENSMUSG00000013629
AA Change: Y1102C

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 1.9e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:ATP-grasp_4 511 692 5.9e-16 PFAM
Pfam:CPSase_L_D2 514 718 1.2e-85 PFAM
Pfam:ATP-grasp 522 690 7.3e-10 PFAM
Pfam:Dala_Dala_lig_C 527 687 1.3e-10 PFAM
CPSase_L_D3 798 921 9.7e-59 SMART
Pfam:ATP-grasp_4 1044 1223 8.9e-24 PFAM
Pfam:CPSase_L_D2 1047 1250 2.1e-28 PFAM
Pfam:Dala_Dala_lig_C 1054 1242 1.3e-7 PFAM
Pfam:ATP-grasp 1055 1222 1.1e-12 PFAM
MGS 1327 1428 1.35e-7 SMART
Pfam:Amidohydro_1 1462 1730 2.5e-11 PFAM
low complexity region 1820 1839 N/A INTRINSIC
low complexity region 1864 1880 N/A INTRINSIC
Pfam:OTCace_N 1970 2004 4.6e-11 PFAM
Pfam:OTCace 2010 2160 9.9e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202827
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The de novo synthesis of pyrimidine nucleotides is required for mammalian cells to proliferate. This gene encodes a trifunctional protein which is associated with the enzymatic activities of the first 3 enzymes in the 6-step pathway of pyrimidine biosynthesis: carbamoylphosphate synthetase (CPS II), aspartate transcarbamoylase, and dihydroorotase. This protein is regulated by the mitogen-activated protein kinase (MAPK) cascade, which indicates a direct link between activation of the MAPK cascade and de novo biosynthesis of pyrimidine nucleotides. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500011B03Rik A T 5: 114,809,273 C64* probably null Het
1700003H04Rik A C 3: 124,575,336 Y109D possibly damaging Het
Abca15 A T 7: 120,340,099 I239F probably damaging Het
Adgrv1 A T 13: 81,556,957 I1578K probably damaging Het
Adgrv1 A G 13: 81,593,048 V99A probably damaging Het
Ap4e1 G T 2: 127,061,555 K792N probably null Het
Ap5b1 G A 19: 5,569,864 W437* probably null Het
Arhgef17 A G 7: 100,930,862 L293P probably benign Het
Arhgef33 A C 17: 80,371,389 M505L probably benign Het
Arih1 T A 9: 59,403,380 R320S probably damaging Het
Atp1b3 A T 9: 96,364,153 M1K probably null Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
Bbs2 T C 8: 94,089,844 D130G possibly damaging Het
Bscl2 G A 19: 8,841,145 R38H probably damaging Het
Cc2d1b G A 4: 108,633,226 R825Q probably damaging Het
Ccdc39 A G 3: 33,839,145 V97A possibly damaging Het
Ccr1 T C 9: 123,964,473 T7A probably benign Het
Cd33 A G 7: 43,532,194 S181P probably damaging Het
Cdc20 A C 4: 118,433,107 S452R probably damaging Het
Cdk8 A T 5: 146,296,378 I229F possibly damaging Het
Ces3a A T 8: 105,050,277 N131Y probably damaging Het
Cgnl1 A G 9: 71,724,590 I493T probably benign Het
Chia1 G A 3: 106,131,904 V437M probably benign Het
Chrna2 G A 14: 66,143,429 R49H probably benign Het
Clec12b A G 6: 129,376,302 C241R probably damaging Het
Col11a1 A G 3: 114,097,154 D380G unknown Het
Crebbp A G 16: 4,115,885 S948P probably damaging Het
Dchs1 G A 7: 105,772,071 R381* probably null Het
Defb19 A T 2: 152,576,165 *84R probably null Het
Dnah8 T C 17: 30,673,888 F816L probably benign Het
Dync2h1 T A 9: 7,103,663 I371F possibly damaging Het
Fggy T C 4: 95,902,058 probably benign Het
Galnt12 G A 4: 47,117,956 C125Y probably damaging Het
Gm4952 A T 19: 12,624,675 D149V probably damaging Het
Gm6309 A T 5: 146,170,583 H37Q possibly damaging Het
Gmnn A G 13: 24,756,632 L78P possibly damaging Het
Golga4 C A 9: 118,555,732 Q613K probably benign Het
Iqgap2 A T 13: 95,630,010 I1495K probably damaging Het
Junb T C 8: 84,978,129 T101A probably damaging Het
Kif21b T C 1: 136,156,111 Y699H probably damaging Het
Klf17 T C 4: 117,760,935 E75G probably damaging Het
Klra17 T C 6: 129,872,314 E99G possibly damaging Het
Knop1 CTCTTCTTCTTCTTCTTCTTCTTC CTCTTCTTCTTCTTCTTCTTC 7: 118,852,449 probably benign Het
Krt83 C T 15: 101,489,657 V167M probably benign Het
Lce1m A G 3: 93,018,625 probably benign Het
Lpin3 A T 2: 160,904,548 Y709F probably damaging Het
Ltbp2 T A 12: 84,791,944 D1080V probably damaging Het
Mycbp2 G A 14: 103,204,389 T1980I probably damaging Het
Myo1g T A 11: 6,515,140 K435M probably damaging Het
Mypn T A 10: 63,169,368 N320I probably damaging Het
Naip5 A T 13: 100,222,206 W841R probably benign Het
Ncapd2 A T 6: 125,170,992 M1124K probably damaging Het
Ncf4 A G 15: 78,262,360 D330G probably benign Het
Ndst3 C T 3: 123,601,455 V509M possibly damaging Het
Neb A T 2: 52,227,244 D4105E probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nsrp1 A T 11: 77,046,619 F250L probably benign Het
Olfr1024 A T 2: 85,904,671 Y128N probably damaging Het
Olfr1087 C T 2: 86,690,797 M59I possibly damaging Het
Olfr552 G T 7: 102,605,302 G316V probably benign Het
Olfr646 C T 7: 104,106,464 L62F probably benign Het
Olfr724 T C 14: 49,961,101 probably null Het
Olfr740 A G 14: 50,453,681 I210V probably benign Het
Oxr1 A G 15: 41,797,474 D67G probably damaging Het
P2ry12 A T 3: 59,218,077 I59N probably damaging Het
Pcdhb12 G T 18: 37,437,058 G419V probably damaging Het
Pdzd2 G T 15: 12,373,829 S2073R possibly damaging Het
Pex5l C A 3: 33,015,013 E112* probably null Het
Plaur A G 7: 24,472,591 D163G probably benign Het
Plk2 A G 13: 110,400,088 Y638C probably benign Het
Ppp1r15b A G 1: 133,133,350 N535S probably benign Het
Ppp2r1b T C 9: 50,870,145 L21P probably damaging Het
Prkar2a G A 9: 108,728,270 V176I possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rag1 A G 2: 101,642,991 M602T possibly damaging Het
Rb1 A G 14: 73,322,084 V60A probably benign Het
Rgs20 T A 1: 4,912,337 I303F probably damaging Het
Rnf43 T A 11: 87,729,431 I240N probably damaging Het
Romo1 G A 2: 156,144,513 V19M probably benign Het
Ryr1 A G 7: 29,070,621 S2676P probably damaging Het
Ryr3 G A 2: 112,709,197 Q3233* probably null Het
Skiv2l G T 17: 34,847,444 P188T probably damaging Het
Slc26a6 A G 9: 108,855,836 R5G probably benign Het
Slc33a1 A G 3: 63,963,955 L79P probably damaging Het
Snx31 G A 15: 36,545,600 R91C probably damaging Het
Tecpr2 T C 12: 110,954,800 I1269T possibly damaging Het
Tjap1 G T 17: 46,261,442 D89E probably benign Het
Tmem53 A T 4: 117,265,893 Q39L probably damaging Het
Tmod1 G T 4: 46,083,549 V95F possibly damaging Het
Trim30c A C 7: 104,382,689 H306Q probably benign Het
Trpm3 A T 19: 22,986,872 M1244L possibly damaging Het
Tspan32 A G 7: 143,005,149 I14V probably null Het
Ube4b A G 4: 149,351,578 V695A probably benign Het
Ubxn11 G A 4: 134,124,141 probably null Het
Ugt3a2 A G 15: 9,361,524 I129V probably benign Het
Vmn1r45 A G 6: 89,933,076 V304A probably damaging Het
Vmn2r124 A T 17: 18,063,273 S410C probably damaging Het
Vmn2r15 T A 5: 109,293,329 D221V probably damaging Het
Vmn2r79 G A 7: 87,037,444 V678I probably benign Het
Vps13b A T 15: 35,438,730 R319* probably null Het
Wdr95 G A 5: 149,599,294 R639Q probably benign Het
Xirp2 A G 2: 67,511,530 I1372V probably benign Het
Xpo5 T A 17: 46,226,980 M611K probably benign Het
Zfat A G 15: 68,212,680 C121R probably damaging Het
Zfp382 A T 7: 30,133,296 Y124F probably benign Het
Zfp512b A G 2: 181,589,189 F371S probably benign Het
Zfy2 A G Y: 2,116,185 V285A probably benign Het
Other mutations in Cad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Cad APN 5 31061484 missense probably damaging 1.00
IGL00908:Cad APN 5 31059054 missense possibly damaging 0.93
IGL01068:Cad APN 5 31061770 splice site probably benign
IGL01638:Cad APN 5 31067614 missense probably damaging 1.00
IGL02483:Cad APN 5 31060826 critical splice acceptor site probably null
IGL02499:Cad APN 5 31069604 missense probably damaging 1.00
IGL02691:Cad APN 5 31055294 missense probably damaging 1.00
IGL03002:Cad APN 5 31054986 missense probably benign 0.00
R0212:Cad UTSW 5 31078110 missense probably damaging 1.00
R0317:Cad UTSW 5 31072321 missense probably benign 0.01
R0335:Cad UTSW 5 31073985 unclassified probably benign
R0401:Cad UTSW 5 31073986 unclassified probably benign
R0445:Cad UTSW 5 31072709 missense probably benign 0.08
R0494:Cad UTSW 5 31077512 unclassified probably benign
R0532:Cad UTSW 5 31062187 splice site probably benign
R0539:Cad UTSW 5 31075457 splice site probably benign
R0578:Cad UTSW 5 31058776 missense probably benign 0.01
R0590:Cad UTSW 5 31062231 missense probably damaging 1.00
R0638:Cad UTSW 5 31077688 missense probably damaging 0.98
R0831:Cad UTSW 5 31067600 missense probably damaging 1.00
R1329:Cad UTSW 5 31059582 missense probably damaging 1.00
R1531:Cad UTSW 5 31076219 missense probably benign 0.14
R1763:Cad UTSW 5 31060951 missense probably damaging 1.00
R1785:Cad UTSW 5 31058072 missense probably damaging 1.00
R1786:Cad UTSW 5 31058072 missense probably damaging 1.00
R2131:Cad UTSW 5 31058072 missense probably damaging 1.00
R2165:Cad UTSW 5 31062220 missense probably damaging 1.00
R3103:Cad UTSW 5 31061674 missense possibly damaging 0.95
R3113:Cad UTSW 5 31074137 missense possibly damaging 0.50
R3762:Cad UTSW 5 31075546 intron probably null
R3847:Cad UTSW 5 31061650 missense probably damaging 1.00
R3898:Cad UTSW 5 31074022 missense probably benign 0.06
R3943:Cad UTSW 5 31072385 critical splice donor site probably null
R4213:Cad UTSW 5 31072344 missense probably benign 0.01
R4458:Cad UTSW 5 31061226 missense probably damaging 1.00
R4562:Cad UTSW 5 31058133 missense possibly damaging 0.82
R4629:Cad UTSW 5 31070295 missense probably damaging 1.00
R4717:Cad UTSW 5 31066686 critical splice acceptor site probably null
R4811:Cad UTSW 5 31074690 missense probably benign 0.02
R5044:Cad UTSW 5 31055021 missense probably benign 0.00
R5630:Cad UTSW 5 31060573 missense probably damaging 1.00
R5660:Cad UTSW 5 31076847 missense probably damaging 1.00
R6008:Cad UTSW 5 31069112 missense probably damaging 1.00
R6029:Cad UTSW 5 31054983 missense possibly damaging 0.65
R6073:Cad UTSW 5 31062562 missense possibly damaging 0.84
R6240:Cad UTSW 5 31072978 missense probably benign 0.00
R6260:Cad UTSW 5 31066800 missense probably null
X0021:Cad UTSW 5 31068131 missense probably null 1.00
X0022:Cad UTSW 5 31072317 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATACCATCGGTATCAGCCAGCCTC -3'
(R):5'- GTTGTCAGACACAAGCCATCCCTC -3'

Sequencing Primer
(F):5'- TATCAGCCAGCCTCAGTGG -3'
(R):5'- ATCCCTCCCGGCCACTG -3'
Posted On2014-04-13