Incidental Mutation 'R1513:Mypn'
Institutional Source Beutler Lab
Gene Symbol Mypn
Ensembl Gene ENSMUSG00000020067
Gene Namemyopalladin
MMRRC Submission 039560-MU
Accession Numbers

Genbank: NM_182992; MGI: 1916052

Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock #R1513 (G1)
Quality Score225
Status Not validated
Chromosomal Location63115795-63203952 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 63169368 bp
Amino Acid Change Asparagine to Isoleucine at position 320 (N320I)
Ref Sequence ENSEMBL: ENSMUSP00000093240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095580]
Predicted Effect probably damaging
Transcript: ENSMUST00000095580
AA Change: N320I

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000093240
Gene: ENSMUSG00000020067
AA Change: N320I

low complexity region 46 56 N/A INTRINSIC
low complexity region 225 245 N/A INTRINSIC
IGc2 279 346 2.16e-8 SMART
low complexity region 384 405 N/A INTRINSIC
IGc2 444 519 1.69e-10 SMART
low complexity region 636 648 N/A INTRINSIC
low complexity region 659 675 N/A INTRINSIC
low complexity region 721 741 N/A INTRINSIC
low complexity region 779 794 N/A INTRINSIC
low complexity region 826 838 N/A INTRINSIC
low complexity region 922 933 N/A INTRINSIC
IGc2 953 1022 1.64e-8 SMART
IGc2 1080 1148 3.67e-11 SMART
IG 1173 1259 1.17e-4 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Striated muscle in vertebrates comprises large proteins which must be organized properly to contract efficiently. Z-lines in striated muscle are a sign of this organization, representing the ends of actin thin filaments, titin, nebulin or nebulette and accessory proteins required for structure and function. This gene encodes a protein which interacts with nebulin in skeletal muscle or nebulette in cardiac muscle and alpha-actinin. In addition, this gene product can interact with a protein with the I-band indicating it has a regulatory as well as structural function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
Allele List at MGI

All alleles(51) : Gene trapped(51)

Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500011B03Rik A T 5: 114,809,273 C64* probably null Het
1700003H04Rik A C 3: 124,575,336 Y109D possibly damaging Het
Abca15 A T 7: 120,340,099 I239F probably damaging Het
Adgrv1 A T 13: 81,556,957 I1578K probably damaging Het
Adgrv1 A G 13: 81,593,048 V99A probably damaging Het
Ap4e1 G T 2: 127,061,555 K792N probably null Het
Ap5b1 G A 19: 5,569,864 W437* probably null Het
Arhgef17 A G 7: 100,930,862 L293P probably benign Het
Arhgef33 A C 17: 80,371,389 M505L probably benign Het
Arih1 T A 9: 59,403,380 R320S probably damaging Het
Atp1b3 A T 9: 96,364,153 M1K probably null Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
Bbs2 T C 8: 94,089,844 D130G possibly damaging Het
Bscl2 G A 19: 8,841,145 R38H probably damaging Het
Cad A G 5: 31,068,762 Y1102C probably damaging Het
Cc2d1b G A 4: 108,633,226 R825Q probably damaging Het
Ccdc39 A G 3: 33,839,145 V97A possibly damaging Het
Ccr1 T C 9: 123,964,473 T7A probably benign Het
Cd33 A G 7: 43,532,194 S181P probably damaging Het
Cdc20 A C 4: 118,433,107 S452R probably damaging Het
Cdk8 A T 5: 146,296,378 I229F possibly damaging Het
Ces3a A T 8: 105,050,277 N131Y probably damaging Het
Cgnl1 A G 9: 71,724,590 I493T probably benign Het
Chia1 G A 3: 106,131,904 V437M probably benign Het
Chrna2 G A 14: 66,143,429 R49H probably benign Het
Clec12b A G 6: 129,376,302 C241R probably damaging Het
Col11a1 A G 3: 114,097,154 D380G unknown Het
Crebbp A G 16: 4,115,885 S948P probably damaging Het
Dchs1 G A 7: 105,772,071 R381* probably null Het
Defb19 A T 2: 152,576,165 *84R probably null Het
Dnah8 T C 17: 30,673,888 F816L probably benign Het
Dync2h1 T A 9: 7,103,663 I371F possibly damaging Het
Fggy T C 4: 95,902,058 probably benign Het
Galnt12 G A 4: 47,117,956 C125Y probably damaging Het
Gm4952 A T 19: 12,624,675 D149V probably damaging Het
Gm6309 A T 5: 146,170,583 H37Q possibly damaging Het
Gmnn A G 13: 24,756,632 L78P possibly damaging Het
Golga4 C A 9: 118,555,732 Q613K probably benign Het
Iqgap2 A T 13: 95,630,010 I1495K probably damaging Het
Junb T C 8: 84,978,129 T101A probably damaging Het
Kif21b T C 1: 136,156,111 Y699H probably damaging Het
Klf17 T C 4: 117,760,935 E75G probably damaging Het
Klra17 T C 6: 129,872,314 E99G possibly damaging Het
Krt83 C T 15: 101,489,657 V167M probably benign Het
Lce1m A G 3: 93,018,625 probably benign Het
Lpin3 A T 2: 160,904,548 Y709F probably damaging Het
Ltbp2 T A 12: 84,791,944 D1080V probably damaging Het
Mycbp2 G A 14: 103,204,389 T1980I probably damaging Het
Myo1g T A 11: 6,515,140 K435M probably damaging Het
Naip5 A T 13: 100,222,206 W841R probably benign Het
Ncapd2 A T 6: 125,170,992 M1124K probably damaging Het
Ncf4 A G 15: 78,262,360 D330G probably benign Het
Ndst3 C T 3: 123,601,455 V509M possibly damaging Het
Neb A T 2: 52,227,244 D4105E probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nsrp1 A T 11: 77,046,619 F250L probably benign Het
Olfr1024 A T 2: 85,904,671 Y128N probably damaging Het
Olfr1087 C T 2: 86,690,797 M59I possibly damaging Het
Olfr552 G T 7: 102,605,302 G316V probably benign Het
Olfr646 C T 7: 104,106,464 L62F probably benign Het
Olfr724 T C 14: 49,961,101 probably null Het
Olfr740 A G 14: 50,453,681 I210V probably benign Het
Oxr1 A G 15: 41,797,474 D67G probably damaging Het
P2ry12 A T 3: 59,218,077 I59N probably damaging Het
Pcdhb12 G T 18: 37,437,058 G419V probably damaging Het
Pdzd2 G T 15: 12,373,829 S2073R possibly damaging Het
Pex5l C A 3: 33,015,013 E112* probably null Het
Plaur A G 7: 24,472,591 D163G probably benign Het
Plk2 A G 13: 110,400,088 Y638C probably benign Het
Ppp1r15b A G 1: 133,133,350 N535S probably benign Het
Ppp2r1b T C 9: 50,870,145 L21P probably damaging Het
Prkar2a G A 9: 108,728,270 V176I possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rag1 A G 2: 101,642,991 M602T possibly damaging Het
Rb1 A G 14: 73,322,084 V60A probably benign Het
Rgs20 T A 1: 4,912,337 I303F probably damaging Het
Rnf43 T A 11: 87,729,431 I240N probably damaging Het
Romo1 G A 2: 156,144,513 V19M probably benign Het
Ryr1 A G 7: 29,070,621 S2676P probably damaging Het
Ryr3 G A 2: 112,709,197 Q3233* probably null Het
Skiv2l G T 17: 34,847,444 P188T probably damaging Het
Slc26a6 A G 9: 108,855,836 R5G probably benign Het
Slc33a1 A G 3: 63,963,955 L79P probably damaging Het
Snx31 G A 15: 36,545,600 R91C probably damaging Het
Tecpr2 T C 12: 110,954,800 I1269T possibly damaging Het
Tjap1 G T 17: 46,261,442 D89E probably benign Het
Tmem53 A T 4: 117,265,893 Q39L probably damaging Het
Tmod1 G T 4: 46,083,549 V95F possibly damaging Het
Trim30c A C 7: 104,382,689 H306Q probably benign Het
Trpm3 A T 19: 22,986,872 M1244L possibly damaging Het
Tspan32 A G 7: 143,005,149 I14V probably null Het
Ube4b A G 4: 149,351,578 V695A probably benign Het
Ubxn11 G A 4: 134,124,141 probably null Het
Ugt3a2 A G 15: 9,361,524 I129V probably benign Het
Vmn1r45 A G 6: 89,933,076 V304A probably damaging Het
Vmn2r124 A T 17: 18,063,273 S410C probably damaging Het
Vmn2r15 T A 5: 109,293,329 D221V probably damaging Het
Vmn2r79 G A 7: 87,037,444 V678I probably benign Het
Vps13b A T 15: 35,438,730 R319* probably null Het
Wdr95 G A 5: 149,599,294 R639Q probably benign Het
Xirp2 A G 2: 67,511,530 I1372V probably benign Het
Xpo5 T A 17: 46,226,980 M611K probably benign Het
Zfat A G 15: 68,212,680 C121R probably damaging Het
Zfp382 A T 7: 30,133,296 Y124F probably benign Het
Zfp512b A G 2: 181,589,189 F371S probably benign Het
Zfy2 A G Y: 2,116,185 V285A probably benign Het
Other mutations in Mypn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00938:Mypn APN 10 63192423 missense probably damaging 1.00
IGL01137:Mypn APN 10 63152854 missense probably benign 0.12
IGL01383:Mypn APN 10 63135797 missense probably damaging 1.00
IGL01560:Mypn APN 10 63134964 missense probably benign 0.27
IGL01569:Mypn APN 10 63127759 missense probably damaging 1.00
IGL02197:Mypn APN 10 63123278 missense possibly damaging 0.69
IGL02829:Mypn APN 10 63192586 missense probably benign 0.01
IGL03221:Mypn APN 10 63131123 missense probably damaging 1.00
IGL03377:Mypn APN 10 63192865 missense probably benign 0.01
2107:Mypn UTSW 10 63203751 utr 5 prime probably benign
R0115:Mypn UTSW 10 63192380 splice site probably benign
R0377:Mypn UTSW 10 63127622 unclassified probably benign
R0480:Mypn UTSW 10 63193203 missense probably benign 0.01
R0581:Mypn UTSW 10 63162244 missense probably benign 0.06
R0669:Mypn UTSW 10 63134923 splice site probably benign
R0822:Mypn UTSW 10 63169256 missense probably damaging 1.00
R1209:Mypn UTSW 10 63118499 missense probably damaging 1.00
R1401:Mypn UTSW 10 63152857 missense probably damaging 0.96
R1750:Mypn UTSW 10 63136197 missense probably benign 0.01
R1780:Mypn UTSW 10 63121964 missense probably damaging 1.00
R1791:Mypn UTSW 10 63125693 missense probably damaging 0.97
R1859:Mypn UTSW 10 63146190 missense probably benign
R1903:Mypn UTSW 10 63123397 missense probably benign 0.06
R2275:Mypn UTSW 10 63131069 missense probably damaging 1.00
R2420:Mypn UTSW 10 63192869 nonsense probably null
R3425:Mypn UTSW 10 63118417 splice site probably benign
R3767:Mypn UTSW 10 63125707 missense possibly damaging 0.88
R3768:Mypn UTSW 10 63125707 missense possibly damaging 0.88
R3770:Mypn UTSW 10 63125707 missense possibly damaging 0.88
R3777:Mypn UTSW 10 63147982 missense possibly damaging 0.92
R3785:Mypn UTSW 10 63193182 missense probably benign 0.43
R3888:Mypn UTSW 10 63192510 missense probably damaging 1.00
R4289:Mypn UTSW 10 63131182 missense probably damaging 1.00
R4301:Mypn UTSW 10 63118484 missense probably damaging 1.00
R4366:Mypn UTSW 10 63192708 missense probably benign 0.00
R4459:Mypn UTSW 10 63192432 missense probably damaging 1.00
R4921:Mypn UTSW 10 63147936 missense possibly damaging 0.75
R4995:Mypn UTSW 10 63119968 intron probably null
R5064:Mypn UTSW 10 63123371 missense possibly damaging 0.68
R5083:Mypn UTSW 10 63118528 missense probably damaging 0.98
R5108:Mypn UTSW 10 63136294 missense probably damaging 1.00
R5399:Mypn UTSW 10 63120186 missense probably benign 0.03
R5438:Mypn UTSW 10 63135839 nonsense probably null
R5590:Mypn UTSW 10 63120048 missense probably benign 0.27
R5652:Mypn UTSW 10 63135801 missense probably damaging 1.00
R5717:Mypn UTSW 10 63127776 missense probably damaging 1.00
R5970:Mypn UTSW 10 63131023 missense probably benign 0.36
R6616:Mypn UTSW 10 63169312 missense probably damaging 1.00
R6930:Mypn UTSW 10 63116939 missense probably damaging 1.00
R6987:Mypn UTSW 10 63193131 missense probably benign 0.00
X0022:Mypn UTSW 10 63136063 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ggttcatgactagtatccccag -3'
(R):5'- cctcctatagctcaggctgac -3'
Posted On2014-04-13