Incidental Mutation 'R1513:Pdzd2'
ID168564
Institutional Source Beutler Lab
Gene Symbol Pdzd2
Ensembl Gene ENSMUSG00000022197
Gene NamePDZ domain containing 2
SynonymsPdzk3, A930022H17Rik, 4930537L06Rik, Gm21706, LOC223364
MMRRC Submission 039560-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.250) question?
Stock #R1513 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location12359711-12739924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 12373829 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 2073 (S2073R)
Ref Sequence ENSEMBL: ENSMUSP00000074788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075317]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075317
AA Change: S2073R

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074788
Gene: ENSMUSG00000022197
AA Change: S2073R

DomainStartEndE-ValueType
PDZ 81 179 1.27e-2 SMART
PDZ 342 419 1.51e-18 SMART
PDZ 597 675 5.25e-18 SMART
low complexity region 690 718 N/A INTRINSIC
PDZ 738 817 1.64e-10 SMART
low complexity region 861 869 N/A INTRINSIC
low complexity region 969 984 N/A INTRINSIC
low complexity region 986 1000 N/A INTRINSIC
low complexity region 1436 1459 N/A INTRINSIC
low complexity region 1525 1537 N/A INTRINSIC
low complexity region 1538 1553 N/A INTRINSIC
low complexity region 1567 1586 N/A INTRINSIC
low complexity region 2111 2129 N/A INTRINSIC
low complexity region 2190 2198 N/A INTRINSIC
low complexity region 2335 2354 N/A INTRINSIC
low complexity region 2469 2479 N/A INTRINSIC
PDZ 2589 2666 1.3e-13 SMART
PDZ 2716 2794 9.42e-20 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains six PDZ domains and shares sequence similarity with pro-interleukin-16 (pro-IL-16). Like pro-IL-16, the encoded protein localizes to the endoplasmic reticulum and is thought to be cleaved by a caspase to produce a secreted peptide containing two PDZ domains. In addition, this gene is upregulated in primary prostate tumors and may be involved in the early stages of prostate tumorigenesis. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit normal response to acute and chronic pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500011B03Rik A T 5: 114,809,273 C64* probably null Het
1700003H04Rik A C 3: 124,575,336 Y109D possibly damaging Het
Abca15 A T 7: 120,340,099 I239F probably damaging Het
Adgrv1 A T 13: 81,556,957 I1578K probably damaging Het
Adgrv1 A G 13: 81,593,048 V99A probably damaging Het
Ap4e1 G T 2: 127,061,555 K792N probably null Het
Ap5b1 G A 19: 5,569,864 W437* probably null Het
Arhgef17 A G 7: 100,930,862 L293P probably benign Het
Arhgef33 A C 17: 80,371,389 M505L probably benign Het
Arih1 T A 9: 59,403,380 R320S probably damaging Het
Atp1b3 A T 9: 96,364,153 M1K probably null Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
Bbs2 T C 8: 94,089,844 D130G possibly damaging Het
Bscl2 G A 19: 8,841,145 R38H probably damaging Het
Cad A G 5: 31,068,762 Y1102C probably damaging Het
Cc2d1b G A 4: 108,633,226 R825Q probably damaging Het
Ccdc39 A G 3: 33,839,145 V97A possibly damaging Het
Ccr1 T C 9: 123,964,473 T7A probably benign Het
Cd33 A G 7: 43,532,194 S181P probably damaging Het
Cdc20 A C 4: 118,433,107 S452R probably damaging Het
Cdk8 A T 5: 146,296,378 I229F possibly damaging Het
Ces3a A T 8: 105,050,277 N131Y probably damaging Het
Cgnl1 A G 9: 71,724,590 I493T probably benign Het
Chia1 G A 3: 106,131,904 V437M probably benign Het
Chrna2 G A 14: 66,143,429 R49H probably benign Het
Clec12b A G 6: 129,376,302 C241R probably damaging Het
Col11a1 A G 3: 114,097,154 D380G unknown Het
Crebbp A G 16: 4,115,885 S948P probably damaging Het
Dchs1 G A 7: 105,772,071 R381* probably null Het
Defb19 A T 2: 152,576,165 *84R probably null Het
Dnah8 T C 17: 30,673,888 F816L probably benign Het
Dync2h1 T A 9: 7,103,663 I371F possibly damaging Het
Fggy T C 4: 95,902,058 probably benign Het
Galnt12 G A 4: 47,117,956 C125Y probably damaging Het
Gm4952 A T 19: 12,624,675 D149V probably damaging Het
Gm6309 A T 5: 146,170,583 H37Q possibly damaging Het
Gmnn A G 13: 24,756,632 L78P possibly damaging Het
Golga4 C A 9: 118,555,732 Q613K probably benign Het
Iqgap2 A T 13: 95,630,010 I1495K probably damaging Het
Junb T C 8: 84,978,129 T101A probably damaging Het
Kif21b T C 1: 136,156,111 Y699H probably damaging Het
Klf17 T C 4: 117,760,935 E75G probably damaging Het
Klra17 T C 6: 129,872,314 E99G possibly damaging Het
Knop1 CTCTTCTTCTTCTTCTTCTTCTTC CTCTTCTTCTTCTTCTTCTTC 7: 118,852,449 probably benign Het
Krt83 C T 15: 101,489,657 V167M probably benign Het
Lce1m A G 3: 93,018,625 probably benign Het
Lpin3 A T 2: 160,904,548 Y709F probably damaging Het
Ltbp2 T A 12: 84,791,944 D1080V probably damaging Het
Mycbp2 G A 14: 103,204,389 T1980I probably damaging Het
Myo1g T A 11: 6,515,140 K435M probably damaging Het
Mypn T A 10: 63,169,368 N320I probably damaging Het
Naip5 A T 13: 100,222,206 W841R probably benign Het
Ncapd2 A T 6: 125,170,992 M1124K probably damaging Het
Ncf4 A G 15: 78,262,360 D330G probably benign Het
Ndst3 C T 3: 123,601,455 V509M possibly damaging Het
Neb A T 2: 52,227,244 D4105E probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nsrp1 A T 11: 77,046,619 F250L probably benign Het
Olfr1024 A T 2: 85,904,671 Y128N probably damaging Het
Olfr1087 C T 2: 86,690,797 M59I possibly damaging Het
Olfr552 G T 7: 102,605,302 G316V probably benign Het
Olfr646 C T 7: 104,106,464 L62F probably benign Het
Olfr724 T C 14: 49,961,101 probably null Het
Olfr740 A G 14: 50,453,681 I210V probably benign Het
Oxr1 A G 15: 41,797,474 D67G probably damaging Het
P2ry12 A T 3: 59,218,077 I59N probably damaging Het
Pcdhb12 G T 18: 37,437,058 G419V probably damaging Het
Pex5l C A 3: 33,015,013 E112* probably null Het
Plaur A G 7: 24,472,591 D163G probably benign Het
Plk2 A G 13: 110,400,088 Y638C probably benign Het
Ppp1r15b A G 1: 133,133,350 N535S probably benign Het
Ppp2r1b T C 9: 50,870,145 L21P probably damaging Het
Prkar2a G A 9: 108,728,270 V176I possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rag1 A G 2: 101,642,991 M602T possibly damaging Het
Rb1 A G 14: 73,322,084 V60A probably benign Het
Rgs20 T A 1: 4,912,337 I303F probably damaging Het
Rnf43 T A 11: 87,729,431 I240N probably damaging Het
Romo1 G A 2: 156,144,513 V19M probably benign Het
Ryr1 A G 7: 29,070,621 S2676P probably damaging Het
Ryr3 G A 2: 112,709,197 Q3233* probably null Het
Skiv2l G T 17: 34,847,444 P188T probably damaging Het
Slc26a6 A G 9: 108,855,836 R5G probably benign Het
Slc33a1 A G 3: 63,963,955 L79P probably damaging Het
Snx31 G A 15: 36,545,600 R91C probably damaging Het
Tecpr2 T C 12: 110,954,800 I1269T possibly damaging Het
Tjap1 G T 17: 46,261,442 D89E probably benign Het
Tmem53 A T 4: 117,265,893 Q39L probably damaging Het
Tmod1 G T 4: 46,083,549 V95F possibly damaging Het
Trim30c A C 7: 104,382,689 H306Q probably benign Het
Trpm3 A T 19: 22,986,872 M1244L possibly damaging Het
Tspan32 A G 7: 143,005,149 I14V probably null Het
Ube4b A G 4: 149,351,578 V695A probably benign Het
Ubxn11 G A 4: 134,124,141 probably null Het
Ugt3a2 A G 15: 9,361,524 I129V probably benign Het
Vmn1r45 A G 6: 89,933,076 V304A probably damaging Het
Vmn2r124 A T 17: 18,063,273 S410C probably damaging Het
Vmn2r15 T A 5: 109,293,329 D221V probably damaging Het
Vmn2r79 G A 7: 87,037,444 V678I probably benign Het
Vps13b A T 15: 35,438,730 R319* probably null Het
Wdr95 G A 5: 149,599,294 R639Q probably benign Het
Xirp2 A G 2: 67,511,530 I1372V probably benign Het
Xpo5 T A 17: 46,226,980 M611K probably benign Het
Zfat A G 15: 68,212,680 C121R probably damaging Het
Zfp382 A T 7: 30,133,296 Y124F probably benign Het
Zfp512b A G 2: 181,589,189 F371S probably benign Het
Zfy2 A G Y: 2,116,185 V285A probably benign Het
Other mutations in Pdzd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pdzd2 APN 15 12457983 missense possibly damaging 0.93
IGL00586:Pdzd2 APN 15 12365767 splice site probably null
IGL00697:Pdzd2 APN 15 12373647 missense possibly damaging 0.81
IGL00721:Pdzd2 APN 15 12374412 missense probably benign 0.00
IGL00971:Pdzd2 APN 15 12374718 missense probably benign 0.00
IGL01066:Pdzd2 APN 15 12402632 unclassified probably benign
IGL01389:Pdzd2 APN 15 12374626 missense possibly damaging 0.56
IGL01505:Pdzd2 APN 15 12458207 missense probably damaging 1.00
IGL01527:Pdzd2 APN 15 12445664 missense probably damaging 1.00
IGL01584:Pdzd2 APN 15 12592483 missense probably damaging 1.00
IGL01763:Pdzd2 APN 15 12372546 missense probably benign
IGL01915:Pdzd2 APN 15 12371639 missense probably damaging 1.00
IGL01947:Pdzd2 APN 15 12592354 missense probably damaging 1.00
IGL02058:Pdzd2 APN 15 12376296 missense possibly damaging 0.87
IGL02274:Pdzd2 APN 15 12445649 missense probably damaging 1.00
IGL02408:Pdzd2 APN 15 12375765 missense probably benign 0.00
IGL02600:Pdzd2 APN 15 12411019 missense probably damaging 1.00
IGL02637:Pdzd2 APN 15 12385634 missense probably benign 0.13
IGL02639:Pdzd2 APN 15 12592243 missense probably damaging 1.00
IGL02712:Pdzd2 APN 15 12376027 missense probably benign 0.00
IGL02967:Pdzd2 APN 15 12374341 missense probably benign 0.04
IGL02992:Pdzd2 APN 15 12382622 missense possibly damaging 0.77
IGL03005:Pdzd2 APN 15 12385265 missense probably damaging 1.00
IGL03067:Pdzd2 APN 15 12388542 critical splice donor site probably null
IGL03335:Pdzd2 APN 15 12373764 missense probably benign 0.00
R0022:Pdzd2 UTSW 15 12371605 missense possibly damaging 0.94
R0241:Pdzd2 UTSW 15 12367941 missense probably damaging 1.00
R0241:Pdzd2 UTSW 15 12367941 missense probably damaging 1.00
R0446:Pdzd2 UTSW 15 12375024 missense probably benign 0.43
R0462:Pdzd2 UTSW 15 12592160 missense probably damaging 1.00
R0562:Pdzd2 UTSW 15 12592278 missense probably damaging 1.00
R0589:Pdzd2 UTSW 15 12376299 missense probably benign 0.03
R0639:Pdzd2 UTSW 15 12458058 missense possibly damaging 0.77
R0925:Pdzd2 UTSW 15 12399270 missense probably damaging 1.00
R1015:Pdzd2 UTSW 15 12374508 missense probably damaging 1.00
R1054:Pdzd2 UTSW 15 12371639 missense probably damaging 1.00
R1070:Pdzd2 UTSW 15 12389966 critical splice donor site probably null
R1099:Pdzd2 UTSW 15 12373087 missense probably damaging 1.00
R1122:Pdzd2 UTSW 15 12457895 missense probably benign 0.25
R1126:Pdzd2 UTSW 15 12458220 missense possibly damaging 0.94
R1381:Pdzd2 UTSW 15 12385439 missense probably benign 0.02
R1385:Pdzd2 UTSW 15 12411022 missense probably benign 0.38
R1538:Pdzd2 UTSW 15 12372961 missense probably damaging 1.00
R1750:Pdzd2 UTSW 15 12385864 missense probably damaging 1.00
R1775:Pdzd2 UTSW 15 12592460 missense probably damaging 1.00
R1801:Pdzd2 UTSW 15 12387654 missense possibly damaging 0.56
R1832:Pdzd2 UTSW 15 12390048 missense probably damaging 1.00
R1856:Pdzd2 UTSW 15 12373855 missense possibly damaging 0.87
R1870:Pdzd2 UTSW 15 12457886 missense probably damaging 1.00
R1879:Pdzd2 UTSW 15 12373900 missense possibly damaging 0.61
R2072:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2073:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2075:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2125:Pdzd2 UTSW 15 12373590 missense probably benign 0.37
R2142:Pdzd2 UTSW 15 12406559 missense probably damaging 1.00
R2155:Pdzd2 UTSW 15 12375793 missense probably benign 0.43
R2282:Pdzd2 UTSW 15 12373848 missense possibly damaging 0.95
R2407:Pdzd2 UTSW 15 12373161 missense probably damaging 1.00
R3545:Pdzd2 UTSW 15 12375471 missense probably benign 0.00
R3878:Pdzd2 UTSW 15 12376176 missense probably benign 0.00
R3879:Pdzd2 UTSW 15 12375508 missense probably damaging 1.00
R4396:Pdzd2 UTSW 15 12387646 missense probably benign 0.36
R4398:Pdzd2 UTSW 15 12375975 missense probably benign 0.30
R4491:Pdzd2 UTSW 15 12385637 missense possibly damaging 0.75
R4492:Pdzd2 UTSW 15 12385637 missense possibly damaging 0.75
R4492:Pdzd2 UTSW 15 12419481 missense possibly damaging 0.48
R4656:Pdzd2 UTSW 15 12385711 missense probably benign 0.00
R4715:Pdzd2 UTSW 15 12419516 missense possibly damaging 0.72
R4803:Pdzd2 UTSW 15 12374595 missense probably benign 0.04
R4893:Pdzd2 UTSW 15 12385343 missense probably benign 0.00
R4959:Pdzd2 UTSW 15 12375648 missense probably damaging 1.00
R4973:Pdzd2 UTSW 15 12375648 missense probably damaging 1.00
R5030:Pdzd2 UTSW 15 12592408 nonsense probably null
R5174:Pdzd2 UTSW 15 12372514 missense probably benign 0.01
R5230:Pdzd2 UTSW 15 12390033 missense probably damaging 1.00
R5256:Pdzd2 UTSW 15 12372942 missense possibly damaging 0.87
R5268:Pdzd2 UTSW 15 12592177 missense probably damaging 1.00
R5488:Pdzd2 UTSW 15 12382676 missense probably benign 0.00
R5489:Pdzd2 UTSW 15 12382676 missense probably benign 0.00
R5588:Pdzd2 UTSW 15 12374281 missense possibly damaging 0.48
R5605:Pdzd2 UTSW 15 12592350 nonsense probably null
R5704:Pdzd2 UTSW 15 12385675 missense probably benign 0.02
R5858:Pdzd2 UTSW 15 12442589 missense probably damaging 0.97
R6048:Pdzd2 UTSW 15 12592570 unclassified probably null
R6222:Pdzd2 UTSW 15 12374566 missense probably damaging 1.00
R6311:Pdzd2 UTSW 15 12458188 missense probably damaging 1.00
R6734:Pdzd2 UTSW 15 12592465 missense probably damaging 1.00
R6897:Pdzd2 UTSW 15 12385865 missense probably damaging 1.00
R6900:Pdzd2 UTSW 15 12374037 missense probably benign
R6955:Pdzd2 UTSW 15 12401464 missense probably damaging 1.00
R6959:Pdzd2 UTSW 15 12375907 missense probably benign 0.17
X0057:Pdzd2 UTSW 15 12411027 missense probably damaging 1.00
X0063:Pdzd2 UTSW 15 12368719 missense possibly damaging 0.77
X0066:Pdzd2 UTSW 15 12372856 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCTGGCATTTTGGAGGGCAGC -3'
(R):5'- GGTCAGACAGAGCAAGCAGTTCAC -3'

Sequencing Primer
(F):5'- GGACCAACGCATTTCCTGTT -3'
(R):5'- GTTCACACACAGCCGAGTAG -3'
Posted On2014-04-13