Incidental Mutation 'R1513:Xpo5'
Institutional Source Beutler Lab
Gene Symbol Xpo5
Ensembl Gene ENSMUSG00000067150
Gene Nameexportin 5
SynonymsExp5, 2700038C24Rik, 2410004H11Rik
MMRRC Submission 039560-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.977) question?
Stock #R1513 (G1)
Quality Score225
Status Not validated
Chromosomal Location46202855-46242299 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46226980 bp
Amino Acid Change Methionine to Lysine at position 611 (M611K)
Ref Sequence ENSEMBL: ENSMUSP00000084257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087031]
Predicted Effect probably benign
Transcript: ENSMUST00000087031
AA Change: M611K

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000084257
Gene: ENSMUSG00000067150
AA Change: M611K

IBN_N 33 100 6.73e-3 SMART
Pfam:Xpo1 109 271 1.4e-34 PFAM
low complexity region 326 342 N/A INTRINSIC
low complexity region 770 779 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102187
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the karyopherin family that is required for the transport of small RNAs and double-stranded RNA-binding proteins from the nucleus to the cytoplasm. The encoded protein translocates cargo through the nuclear pore complex in a RanGTP-dependent process. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500011B03Rik A T 5: 114,809,273 C64* probably null Het
1700003H04Rik A C 3: 124,575,336 Y109D possibly damaging Het
Abca15 A T 7: 120,340,099 I239F probably damaging Het
Adgrv1 A T 13: 81,556,957 I1578K probably damaging Het
Adgrv1 A G 13: 81,593,048 V99A probably damaging Het
Ap4e1 G T 2: 127,061,555 K792N probably null Het
Ap5b1 G A 19: 5,569,864 W437* probably null Het
Arhgef17 A G 7: 100,930,862 L293P probably benign Het
Arhgef33 A C 17: 80,371,389 M505L probably benign Het
Arih1 T A 9: 59,403,380 R320S probably damaging Het
Atp1b3 A T 9: 96,364,153 M1K probably null Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
Bbs2 T C 8: 94,089,844 D130G possibly damaging Het
Bscl2 G A 19: 8,841,145 R38H probably damaging Het
Cad A G 5: 31,068,762 Y1102C probably damaging Het
Cc2d1b G A 4: 108,633,226 R825Q probably damaging Het
Ccdc39 A G 3: 33,839,145 V97A possibly damaging Het
Ccr1 T C 9: 123,964,473 T7A probably benign Het
Cd33 A G 7: 43,532,194 S181P probably damaging Het
Cdc20 A C 4: 118,433,107 S452R probably damaging Het
Cdk8 A T 5: 146,296,378 I229F possibly damaging Het
Ces3a A T 8: 105,050,277 N131Y probably damaging Het
Cgnl1 A G 9: 71,724,590 I493T probably benign Het
Chia1 G A 3: 106,131,904 V437M probably benign Het
Chrna2 G A 14: 66,143,429 R49H probably benign Het
Clec12b A G 6: 129,376,302 C241R probably damaging Het
Col11a1 A G 3: 114,097,154 D380G unknown Het
Crebbp A G 16: 4,115,885 S948P probably damaging Het
Dchs1 G A 7: 105,772,071 R381* probably null Het
Defb19 A T 2: 152,576,165 *84R probably null Het
Dnah8 T C 17: 30,673,888 F816L probably benign Het
Dync2h1 T A 9: 7,103,663 I371F possibly damaging Het
Fggy T C 4: 95,902,058 probably benign Het
Galnt12 G A 4: 47,117,956 C125Y probably damaging Het
Gm4952 A T 19: 12,624,675 D149V probably damaging Het
Gm6309 A T 5: 146,170,583 H37Q possibly damaging Het
Gmnn A G 13: 24,756,632 L78P possibly damaging Het
Golga4 C A 9: 118,555,732 Q613K probably benign Het
Iqgap2 A T 13: 95,630,010 I1495K probably damaging Het
Junb T C 8: 84,978,129 T101A probably damaging Het
Kif21b T C 1: 136,156,111 Y699H probably damaging Het
Klf17 T C 4: 117,760,935 E75G probably damaging Het
Klra17 T C 6: 129,872,314 E99G possibly damaging Het
Krt83 C T 15: 101,489,657 V167M probably benign Het
Lce1m A G 3: 93,018,625 probably benign Het
Lpin3 A T 2: 160,904,548 Y709F probably damaging Het
Ltbp2 T A 12: 84,791,944 D1080V probably damaging Het
Mycbp2 G A 14: 103,204,389 T1980I probably damaging Het
Myo1g T A 11: 6,515,140 K435M probably damaging Het
Mypn T A 10: 63,169,368 N320I probably damaging Het
Naip5 A T 13: 100,222,206 W841R probably benign Het
Ncapd2 A T 6: 125,170,992 M1124K probably damaging Het
Ncf4 A G 15: 78,262,360 D330G probably benign Het
Ndst3 C T 3: 123,601,455 V509M possibly damaging Het
Neb A T 2: 52,227,244 D4105E probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nsrp1 A T 11: 77,046,619 F250L probably benign Het
Olfr1024 A T 2: 85,904,671 Y128N probably damaging Het
Olfr1087 C T 2: 86,690,797 M59I possibly damaging Het
Olfr552 G T 7: 102,605,302 G316V probably benign Het
Olfr646 C T 7: 104,106,464 L62F probably benign Het
Olfr724 T C 14: 49,961,101 probably null Het
Olfr740 A G 14: 50,453,681 I210V probably benign Het
Oxr1 A G 15: 41,797,474 D67G probably damaging Het
P2ry12 A T 3: 59,218,077 I59N probably damaging Het
Pcdhb12 G T 18: 37,437,058 G419V probably damaging Het
Pdzd2 G T 15: 12,373,829 S2073R possibly damaging Het
Pex5l C A 3: 33,015,013 E112* probably null Het
Plaur A G 7: 24,472,591 D163G probably benign Het
Plk2 A G 13: 110,400,088 Y638C probably benign Het
Ppp1r15b A G 1: 133,133,350 N535S probably benign Het
Ppp2r1b T C 9: 50,870,145 L21P probably damaging Het
Prkar2a G A 9: 108,728,270 V176I possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rag1 A G 2: 101,642,991 M602T possibly damaging Het
Rb1 A G 14: 73,322,084 V60A probably benign Het
Rgs20 T A 1: 4,912,337 I303F probably damaging Het
Rnf43 T A 11: 87,729,431 I240N probably damaging Het
Romo1 G A 2: 156,144,513 V19M probably benign Het
Ryr1 A G 7: 29,070,621 S2676P probably damaging Het
Ryr3 G A 2: 112,709,197 Q3233* probably null Het
Skiv2l G T 17: 34,847,444 P188T probably damaging Het
Slc26a6 A G 9: 108,855,836 R5G probably benign Het
Slc33a1 A G 3: 63,963,955 L79P probably damaging Het
Snx31 G A 15: 36,545,600 R91C probably damaging Het
Tecpr2 T C 12: 110,954,800 I1269T possibly damaging Het
Tjap1 G T 17: 46,261,442 D89E probably benign Het
Tmem53 A T 4: 117,265,893 Q39L probably damaging Het
Tmod1 G T 4: 46,083,549 V95F possibly damaging Het
Trim30c A C 7: 104,382,689 H306Q probably benign Het
Trpm3 A T 19: 22,986,872 M1244L possibly damaging Het
Tspan32 A G 7: 143,005,149 I14V probably null Het
Ube4b A G 4: 149,351,578 V695A probably benign Het
Ubxn11 G A 4: 134,124,141 probably null Het
Ugt3a2 A G 15: 9,361,524 I129V probably benign Het
Vmn1r45 A G 6: 89,933,076 V304A probably damaging Het
Vmn2r124 A T 17: 18,063,273 S410C probably damaging Het
Vmn2r15 T A 5: 109,293,329 D221V probably damaging Het
Vmn2r79 G A 7: 87,037,444 V678I probably benign Het
Vps13b A T 15: 35,438,730 R319* probably null Het
Wdr95 G A 5: 149,599,294 R639Q probably benign Het
Xirp2 A G 2: 67,511,530 I1372V probably benign Het
Zfat A G 15: 68,212,680 C121R probably damaging Het
Zfp382 A T 7: 30,133,296 Y124F probably benign Het
Zfp512b A G 2: 181,589,189 F371S probably benign Het
Zfy2 A G Y: 2,116,185 V285A probably benign Het
Other mutations in Xpo5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Xpo5 APN 17 46225047 missense probably damaging 1.00
IGL00650:Xpo5 APN 17 46208246 missense probably damaging 1.00
IGL00785:Xpo5 APN 17 46204692 missense probably damaging 1.00
IGL01869:Xpo5 APN 17 46242207 missense possibly damaging 0.75
IGL01929:Xpo5 APN 17 46202929 missense probably benign 0.13
IGL02433:Xpo5 APN 17 46239520 missense probably damaging 0.99
IGL02550:Xpo5 APN 17 46229329 missense probably benign 0.16
IGL02637:Xpo5 APN 17 46235979 missense probably damaging 1.00
IGL02942:Xpo5 APN 17 46208133 missense probably damaging 0.99
IGL03004:Xpo5 APN 17 46207840 missense probably damaging 1.00
IGL03149:Xpo5 APN 17 46215814 splice site probably null
IGL03296:Xpo5 APN 17 46221394 nonsense probably null
R0009:Xpo5 UTSW 17 46204786 splice site probably benign
R0009:Xpo5 UTSW 17 46204786 splice site probably benign
R0035:Xpo5 UTSW 17 46240175 missense probably benign
R0276:Xpo5 UTSW 17 46241507 missense probably damaging 1.00
R0626:Xpo5 UTSW 17 46221433 missense probably damaging 1.00
R0843:Xpo5 UTSW 17 46222650 splice site probably benign
R1440:Xpo5 UTSW 17 46207927 splice site probably benign
R1506:Xpo5 UTSW 17 46227888 missense probably benign 0.04
R2060:Xpo5 UTSW 17 46225091 missense probably damaging 1.00
R2258:Xpo5 UTSW 17 46240896 nonsense probably null
R2259:Xpo5 UTSW 17 46240896 nonsense probably null
R2260:Xpo5 UTSW 17 46240896 nonsense probably null
R2263:Xpo5 UTSW 17 46230343 missense probably benign
R3016:Xpo5 UTSW 17 46220831 missense probably damaging 1.00
R3149:Xpo5 UTSW 17 46242247 synonymous probably null
R3150:Xpo5 UTSW 17 46242247 synonymous probably null
R4613:Xpo5 UTSW 17 46236963 missense probably benign
R4784:Xpo5 UTSW 17 46222717 missense possibly damaging 0.59
R4808:Xpo5 UTSW 17 46235970 missense probably benign 0.36
R4981:Xpo5 UTSW 17 46220817 missense probably damaging 0.99
R5159:Xpo5 UTSW 17 46217609 missense probably damaging 1.00
R5286:Xpo5 UTSW 17 46234480 missense probably benign
R5294:Xpo5 UTSW 17 46236922 missense probably benign 0.12
R5550:Xpo5 UTSW 17 46234492 missense possibly damaging 0.87
R5750:Xpo5 UTSW 17 46218630 critical splice donor site probably null
R5774:Xpo5 UTSW 17 46241846 nonsense probably null
R5921:Xpo5 UTSW 17 46221421 missense probably benign 0.01
R6165:Xpo5 UTSW 17 46235957 missense possibly damaging 0.53
R6576:Xpo5 UTSW 17 46240808 splice site probably null
X0019:Xpo5 UTSW 17 46234544 missense probably benign 0.00
X0062:Xpo5 UTSW 17 46230266 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tcagtagaaaaattacaggcatgaag -3'
Posted On2014-04-13