Incidental Mutation 'R1514:Specc1'
ID168632
Institutional Source Beutler Lab
Gene Symbol Specc1
Ensembl Gene ENSMUSG00000042331
Gene Namesperm antigen with calponin homology and coiled-coil domains 1
SynonymsCytsb
MMRRC Submission 039561-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.526) question?
Stock #R1514 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location61956763-62223013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 62156532 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 909 (L909H)
Ref Sequence ENSEMBL: ENSMUSP00000144311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092415] [ENSMUST00000108709] [ENSMUST00000201015] [ENSMUST00000201364] [ENSMUST00000202179] [ENSMUST00000202389] [ENSMUST00000202905]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092415
AA Change: L829H

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000090071
Gene: ENSMUSG00000042331
AA Change: L829H

DomainStartEndE-ValueType
low complexity region 43 63 N/A INTRINSIC
coiled coil region 79 116 N/A INTRINSIC
coiled coil region 144 179 N/A INTRINSIC
low complexity region 231 236 N/A INTRINSIC
coiled coil region 282 374 N/A INTRINSIC
coiled coil region 399 440 N/A INTRINSIC
coiled coil region 495 693 N/A INTRINSIC
low complexity region 805 816 N/A INTRINSIC
low complexity region 832 844 N/A INTRINSIC
CH 883 981 2.69e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108709
AA Change: L909H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104349
Gene: ENSMUSG00000042331
AA Change: L909H

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
low complexity region 885 896 N/A INTRINSIC
low complexity region 912 924 N/A INTRINSIC
CH 963 1061 2.69e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201015
AA Change: L249H

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000144174
Gene: ENSMUSG00000042331
AA Change: L249H

DomainStartEndE-ValueType
coiled coil region 23 113 N/A INTRINSIC
low complexity region 225 236 N/A INTRINSIC
low complexity region 252 264 N/A INTRINSIC
CH 303 401 1.4e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201364
AA Change: L900H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143853
Gene: ENSMUSG00000042331
AA Change: L900H

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
low complexity region 903 915 N/A INTRINSIC
CH 954 1052 2.69e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202179
AA Change: L820H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144300
Gene: ENSMUSG00000042331
AA Change: L820H

DomainStartEndE-ValueType
low complexity region 43 63 N/A INTRINSIC
coiled coil region 79 116 N/A INTRINSIC
coiled coil region 144 179 N/A INTRINSIC
low complexity region 231 236 N/A INTRINSIC
coiled coil region 282 374 N/A INTRINSIC
coiled coil region 399 440 N/A INTRINSIC
coiled coil region 495 693 N/A INTRINSIC
low complexity region 796 807 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
CH 874 972 2.69e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202389
AA Change: L909H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144055
Gene: ENSMUSG00000042331
AA Change: L909H

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
low complexity region 885 896 N/A INTRINSIC
low complexity region 912 924 N/A INTRINSIC
CH 963 1061 2.69e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202905
AA Change: L909H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144311
Gene: ENSMUSG00000042331
AA Change: L909H

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
low complexity region 885 896 N/A INTRINSIC
low complexity region 912 924 N/A INTRINSIC
CH 963 1061 2.69e-16 SMART
Meta Mutation Damage Score 0.184 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cytospin-A family. It is localized in the nucleus, and highly expressed in testis and some cancer cell lines. A chromosomal translocation involving this gene and platelet-derived growth factor receptor, beta gene (PDGFRB) may be a cause of juvenile myelomonocytic leukemia. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,612,867 L147Q probably damaging Het
Abcb1a A G 5: 8,674,791 T75A possibly damaging Het
Acvr1 A T 2: 58,447,585 L495* probably null Het
Add1 T C 5: 34,610,617 I240T probably benign Het
Adgra2 C A 8: 27,121,278 S870* probably null Het
Amer3 G A 1: 34,579,327 probably benign Het
Baz2b A T 2: 59,962,326 V486D probably benign Het
Bcorl1 T A X: 48,405,944 D1697E probably damaging Het
Cenpf T C 1: 189,679,141 D282G possibly damaging Het
Cep112 A G 11: 108,472,054 D200G probably damaging Het
Clec4a4 C T 6: 122,990,442 P26S probably benign Het
Crygf A C 1: 65,928,038 R102S possibly damaging Het
Cyp2b19 A T 7: 26,767,160 E404D probably benign Het
Dcdc2a A G 13: 25,061,254 I105V probably benign Het
Dus4l T C 12: 31,640,939 M238V probably damaging Het
Eprs G A 1: 185,381,834 M326I probably damaging Het
Evpl T C 11: 116,223,835 T1010A probably benign Het
Fam124b T C 1: 80,200,431 T284A possibly damaging Het
Fam84a C T 12: 14,149,863 V288M probably damaging Het
Glb1l2 A G 9: 26,769,124 probably benign Het
Gm15922 G A 7: 3,739,640 T23I possibly damaging Het
Gm16223 T A 5: 42,067,955 probably null Het
Gm438 T C 4: 144,777,759 N274S probably damaging Het
Gm4952 T A 19: 12,626,914 M230K probably damaging Het
Gm5828 C A 1: 16,769,359 noncoding transcript Het
Gm597 T A 1: 28,778,748 T68S possibly damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifna16 T A 4: 88,676,742 T39S possibly damaging Het
Kcnc3 G A 7: 44,595,603 G439D probably damaging Het
Kif1c T C 11: 70,705,729 S257P probably damaging Het
Kng1 A G 16: 23,079,760 K456E probably damaging Het
Lpxn T C 19: 12,824,050 L142P probably damaging Het
Med23 A G 10: 24,892,667 probably benign Het
Mgea5 A G 19: 45,776,931 S146P probably damaging Het
Mks1 A T 11: 87,861,111 D369V probably benign Het
Myo1d A T 11: 80,685,908 Y114N probably damaging Het
Npas2 A G 1: 39,311,854 D126G possibly damaging Het
Olfr1314 T C 2: 112,092,036 I222V probably benign Het
Olfr1420 A G 19: 11,896,614 T198A probably benign Het
Olfr148 T C 9: 39,613,696 I43T probably damaging Het
Onecut2 T C 18: 64,341,580 F401L possibly damaging Het
Parp11 T A 6: 127,474,293 F102Y possibly damaging Het
Pcnx C T 12: 81,918,798 H580Y probably damaging Het
Pde3b A G 7: 114,530,766 H852R probably damaging Het
Pou2af1 A G 9: 51,233,208 T141A probably benign Het
Rgs22 A C 15: 36,013,100 V1190G probably benign Het
Rnf112 T C 11: 61,450,410 S450G probably benign Het
Rpgrip1l A T 8: 91,260,750 I893N probably damaging Het
Rps3a1 A G 3: 86,138,527 V210A probably benign Het
Runx2 C T 17: 44,735,337 A114T possibly damaging Het
Sardh A G 2: 27,197,690 V723A possibly damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Secisbp2 A G 13: 51,682,095 S742G possibly damaging Het
Selenow G T 7: 15,920,298 probably benign Het
Slc30a4 A G 2: 122,689,414 V226A probably damaging Het
Sntb2 A G 8: 106,991,532 N291D probably damaging Het
Sorbs2 A G 8: 45,769,829 T190A probably damaging Het
Sprr1b T C 3: 92,437,107 *154W probably null Het
Taar4 T A 10: 23,960,612 M40K possibly damaging Het
Ubr2 A T 17: 47,000,823 L34H probably damaging Het
Ubxn6 T C 17: 56,069,003 K386R probably benign Het
Vmn2r112 A T 17: 22,602,844 T168S probably benign Het
Xirp2 A T 2: 67,514,323 R2303* probably null Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp13 G T 17: 23,576,412 T395K probably damaging Het
Zfp281 A G 1: 136,626,697 N471S probably benign Het
Other mutations in Specc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Specc1 APN 11 62118009 missense probably benign 0.02
IGL01953:Specc1 APN 11 62118296 missense probably benign 0.40
IGL02244:Specc1 APN 11 62128368 missense probably benign 0.41
IGL02257:Specc1 APN 11 62118417 missense probably damaging 1.00
IGL02512:Specc1 APN 11 62118389 missense probably damaging 1.00
IGL03147:Specc1 UTSW 11 62118282 missense probably benign
R0039:Specc1 UTSW 11 62029369 missense probably damaging 0.97
R0114:Specc1 UTSW 11 62146313 missense possibly damaging 0.92
R0635:Specc1 UTSW 11 62118903 missense probably damaging 1.00
R1604:Specc1 UTSW 11 62043057 missense probably damaging 1.00
R1717:Specc1 UTSW 11 62128392 missense possibly damaging 0.88
R1719:Specc1 UTSW 11 62128392 missense possibly damaging 0.88
R1739:Specc1 UTSW 11 62118818 nonsense probably null
R1757:Specc1 UTSW 11 62119284 critical splice donor site probably null
R1990:Specc1 UTSW 11 62029294 missense possibly damaging 0.87
R1991:Specc1 UTSW 11 62029294 missense possibly damaging 0.87
R2063:Specc1 UTSW 11 62118296 missense probably benign 0.01
R2071:Specc1 UTSW 11 62117875 missense probably damaging 0.98
R2245:Specc1 UTSW 11 62131887 missense probably damaging 1.00
R3415:Specc1 UTSW 11 62118419 missense probably benign 0.29
R3831:Specc1 UTSW 11 62117967 missense probably damaging 1.00
R3890:Specc1 UTSW 11 62151913 missense probably benign 0.00
R3891:Specc1 UTSW 11 62151913 missense probably benign 0.00
R4367:Specc1 UTSW 11 62118530 missense probably damaging 1.00
R4489:Specc1 UTSW 11 62151827 intron probably null
R4580:Specc1 UTSW 11 62219331 missense probably damaging 1.00
R4852:Specc1 UTSW 11 62211684 missense probably damaging 1.00
R4930:Specc1 UTSW 11 62118958 missense possibly damaging 0.93
R5016:Specc1 UTSW 11 62118957 missense possibly damaging 0.92
R5416:Specc1 UTSW 11 62118909 missense probably benign 0.00
R5650:Specc1 UTSW 11 62117967 missense probably damaging 1.00
R6158:Specc1 UTSW 11 62118124 missense probably damaging 0.99
R6329:Specc1 UTSW 11 62156553 missense probably damaging 1.00
R6374:Specc1 UTSW 11 62156592 missense possibly damaging 0.93
R6395:Specc1 UTSW 11 62132338 missense probably damaging 1.00
R6653:Specc1 UTSW 11 62146418 missense probably damaging 0.99
R6893:Specc1 UTSW 11 62132453 missense probably benign
R6898:Specc1 UTSW 11 62118336 missense probably benign
R7054:Specc1 UTSW 11 62117778 missense probably damaging 0.96
R7294:Specc1 UTSW 11 62118337 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCTGGAGATAGAAGATACCATGTCCC -3'
(R):5'- TGCTGTCATTCAGAAGTAAGCTGACTG -3'

Sequencing Primer
(F):5'- AGTATGATAACCAGATTACTCCCC -3'
(R):5'- TTCAGAAGTAAGCTGACTGTGGATG -3'
Posted On2014-04-13