Incidental Mutation 'R1499:Olfr429'
ID168663
Institutional Source Beutler Lab
Gene Symbol Olfr429
Ensembl Gene ENSMUSG00000049528
Gene Nameolfactory receptor 429
SynonymsMOR105-1, GA_x6K02T2P20D-21090094-21089156
MMRRC Submission 039550-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R1499 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location174084331-174091343 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 174089247 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 69 (L69*)
Ref Sequence ENSEMBL: ENSMUSP00000149257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060693] [ENSMUST00000216346]
Predicted Effect probably null
Transcript: ENSMUST00000060693
AA Change: L69*
SMART Domains Protein: ENSMUSP00000051323
Gene: ENSMUSG00000049528
AA Change: L69*

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.2e-65 PFAM
Pfam:7tm_1 41 290 1.3e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000193320
AA Change: L69*
SMART Domains Protein: ENSMUSP00000142323
Gene: ENSMUSG00000049528
AA Change: L69*

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
Pfam:7tm_1 41 290 8.9e-31 PFAM
Pfam:7tm_4 139 283 6.7e-43 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000216346
AA Change: L69*
Meta Mutation Damage Score 0.6528 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.4%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,921,718 S199T probably benign Het
Abca9 T A 11: 110,139,632 Y763F probably benign Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Actl11 A G 9: 107,931,483 T1002A probably damaging Het
Ampd1 T A 3: 103,091,664 N378K probably damaging Het
Arhgap42 A G 9: 9,033,586 probably benign Het
Arhgap6 C A X: 168,796,503 P95T possibly damaging Het
Atg14 T C 14: 47,560,645 N87S probably benign Het
Atp9b C T 18: 80,762,138 C735Y probably damaging Het
Atp9b T A 18: 80,778,907 T110S probably benign Het
Birc6 T G 17: 74,612,319 L221R probably damaging Het
Ces1c A G 8: 93,127,605 F101L probably benign Het
Chsy1 T C 7: 66,172,002 Y662H probably damaging Het
Cldn12 A T 5: 5,507,900 F176I probably benign Het
Col5a2 A G 1: 45,411,466 S374P probably benign Het
Col6a2 A T 10: 76,603,710 V740E probably damaging Het
Cpne3 A T 4: 19,526,336 I401K probably damaging Het
Cspp1 T A 1: 10,088,966 probably null Het
Ddn G A 15: 98,806,766 T215I possibly damaging Het
Dync1i1 T C 6: 5,769,799 probably benign Het
Dync2li1 T C 17: 84,647,239 probably benign Het
Eif2a T A 3: 58,537,584 L50* probably null Het
Elavl3 G A 9: 22,018,579 A343V probably damaging Het
Fastkd1 T C 2: 69,708,638 probably null Het
Fgf8 C A 19: 45,742,347 V80F possibly damaging Het
Fras1 A T 5: 96,743,187 E2858D probably benign Het
Fshr A T 17: 88,986,101 L383Q probably damaging Het
Glb1 A G 9: 114,417,103 K74R probably benign Het
Gmeb2 T G 2: 181,255,226 M290L probably benign Het
Gnptg A G 17: 25,235,854 probably null Het
Grik2 A C 10: 49,132,775 S739A probably damaging Het
Grk2 T A 19: 4,287,194 Q659L probably benign Het
Hdhd5 A G 6: 120,514,512 V210A probably damaging Het
Hyal1 C T 9: 107,577,892 L134F probably damaging Het
Itgb2 A T 10: 77,546,153 K18N possibly damaging Het
Jam3 A T 9: 27,106,405 I29K possibly damaging Het
Kcnh3 C A 15: 99,239,915 D830E probably benign Het
Kcnmb4 T C 10: 116,473,298 D75G possibly damaging Het
Kdm4b A G 17: 56,400,025 Y981C probably damaging Het
Klk1b26 C A 7: 44,016,386 D207E probably benign Het
Kmt2a G T 9: 44,848,266 T762N probably benign Het
Kmt2d A G 15: 98,844,938 probably benign Het
Lama4 T C 10: 39,088,880 S1414P possibly damaging Het
Lce1f C G 3: 92,718,969 C127S unknown Het
Maats1 A G 16: 38,321,400 V390A probably damaging Het
Map7d1 A G 4: 126,234,765 probably null Het
Ninl T C 2: 150,980,176 D2G possibly damaging Het
Olfr1029 C T 2: 85,976,028 P262S possibly damaging Het
Olfr1369-ps1 T A 13: 21,116,133 M147K probably benign Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr195 A G 16: 59,148,924 T25A probably benign Het
Pax8 A G 2: 24,429,596 Y381H possibly damaging Het
Pde7a T C 3: 19,260,244 I63V possibly damaging Het
Pgm3 A T 9: 86,570,287 F40Y probably benign Het
Phrf1 G T 7: 141,256,651 D78Y probably damaging Het
Plekhg1 C T 10: 3,940,538 probably benign Het
Pum1 T C 4: 130,719,256 S209P probably damaging Het
Qtrt2 A T 16: 43,868,974 F220L probably benign Het
Rgs9 A G 11: 109,268,921 probably null Het
Rin3 A G 12: 102,368,759 T230A unknown Het
Ros1 A T 10: 52,098,677 V1604E possibly damaging Het
Rpp14 A G 14: 8,090,528 M151V probably benign Het
Sacs T A 14: 61,213,704 F4400I possibly damaging Het
Scamp1 C T 13: 94,224,929 V148I probably benign Het
Slc13a5 A G 11: 72,250,731 C428R probably damaging Het
Slc43a2 T G 11: 75,562,907 probably null Het
Smarcc2 T A 10: 128,463,872 N135K probably damaging Het
Snx15 G C 19: 6,122,064 S116R probably damaging Het
Stag1 A G 9: 100,855,832 E414G possibly damaging Het
Stag1 A T 9: 100,887,373 probably benign Het
Tmem106a T A 11: 101,590,437 L257Q possibly damaging Het
Tnc C T 4: 63,964,754 D1968N probably benign Het
Trim42 A G 9: 97,366,085 L186P possibly damaging Het
Tshb T A 3: 102,778,308 probably benign Het
Ttn T A 2: 76,754,140 D13881V probably damaging Het
Uqcrc2 T C 7: 120,640,283 V56A probably benign Het
Uty G A Y: 1,197,228 T113I probably damaging Het
Vps13c A G 9: 67,957,505 E3032G probably benign Het
Wfdc9 T G 2: 164,651,809 probably benign Het
Zc3h7a G A 16: 11,162,656 T31I probably damaging Het
Zfp462 T C 4: 55,060,046 S1191P probably damaging Het
Other mutations in Olfr429
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Olfr429 APN 1 174089556 missense probably damaging 1.00
IGL01868:Olfr429 APN 1 174089370 missense possibly damaging 0.83
IGL01972:Olfr429 APN 1 174089421 missense probably damaging 0.99
IGL02412:Olfr429 APN 1 174089243 missense probably benign 0.00
IGL02628:Olfr429 APN 1 174089190 missense probably benign
IGL02861:Olfr429 APN 1 174089036 utr 5 prime probably benign
IGL03404:Olfr429 APN 1 174089898 missense probably damaging 1.00
R0267:Olfr429 UTSW 1 174089166 missense probably damaging 1.00
R0357:Olfr429 UTSW 1 174089109 missense possibly damaging 0.71
R2051:Olfr429 UTSW 1 174089219 missense possibly damaging 0.95
R4706:Olfr429 UTSW 1 174089702 missense probably damaging 1.00
R4820:Olfr429 UTSW 1 174089176 missense possibly damaging 0.95
R5439:Olfr429 UTSW 1 174089975 missense probably benign 0.01
R5538:Olfr429 UTSW 1 174089978 makesense probably null
R5907:Olfr429 UTSW 1 174089219 missense probably benign 0.08
R6932:Olfr429 UTSW 1 174089750 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGATGCCAATGGCTACTTTCTCCC -3'
(R):5'- GGCCTGCAAATGGCTAAGTACCTG -3'

Sequencing Primer
(F):5'- CTGGAGCCAAGTAATAGAATTCATC -3'
(R):5'- TGGCTAAGTACCTGTCATATGC -3'
Posted On2014-04-13