Mutagenetix > Incidental Mutation

Incidental Mutation 'R1499:Jam3'

168697

Institutional Source

Beutler Lab

Gene Symbol

Jam3

Ensembl Gene

ENSMUSG00000031990

Gene Name

junction adhesion molecule 3

Synonyms

1110002N23Rik, Jcam3, JAM-3, JAM-C

MMRRC Submission

039550-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.654) question?

Stock #

R1499 (G1)

Quality Score

209

Status

Validated

Chromosome

Chromosomal Location

27008680-27066717 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 27017701 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 29 (I29K)

Ref Sequence

ENSEMBL: ENSMUSP00000034472 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034472]

AlphaFold

Q9D8B7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034472
AA Change: I29K

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000034472
Gene: ENSMUSG00000031990
AA Change: I29K

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
IG	38	136	2.7e-9	SMART
IGc2	151	226	8.12e-13	SMART
transmembrane domain	245	267	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167074

SMART Domains

Protein: ENSMUSP00000128003
Gene: ENSMUSG00000031990

Domain	Start	End	E-Value	Type
low complexity region	3	15	N/A	INTRINSIC
low complexity region	18	24	N/A	INTRINSIC
IG	38	136	2.7e-9	SMART
Pfam:C2-set_2	138	206	4.8e-7	PFAM
Pfam:Ig_3	139	206	7.1e-5	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213170

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213682

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215446

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217654

Meta Mutation Damage Score

0.1342

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 93.4%

Validation Efficiency

99% (83/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. The protein encoded by this immunoglobulin superfamily gene member is localized in the tight junctions between high endothelial cells. Unlike other proteins in this family, the this protein is unable to adhere to leukocyte cell lines and only forms weak homotypic interactions. The encoded protein is a member of the junctional adhesion molecule protein family and acts as a receptor for another member of this family. A mutation in an intron of this gene is associated with hemorrhagic destruction of the brain, subependymal calcification, and congenital cataracts. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Apr 2011]
PHENOTYPE: Approximately 60% of mice homozygous for a targeted mutation exhibit postnatal lethality. Males are infertile and display small testes and arrested differentiation of round spermatids into spermatozoa, as shown by the absence of acrosomes, elongated nuclei, and morphological signs of polarization. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	T	A	11: 110,030,458 (GRCm39)	Y763F	probably benign	Het
Abcb10	C	T	8: 124,688,791 (GRCm39)	G495D	probably damaging	Het
Actl11	A	G	9: 107,808,682 (GRCm39)	T1002A	probably damaging	Het
Ampd1	T	A	3: 102,998,980 (GRCm39)	N378K	probably damaging	Het
Arhgap42	A	G	9: 9,033,587 (GRCm39)		probably benign	Het
Arhgap6	C	A	X: 167,579,499 (GRCm39)	P95T	possibly damaging	Het
Atg14	T	C	14: 47,798,102 (GRCm39)	N87S	probably benign	Het
Atp9b	C	T	18: 80,805,353 (GRCm39)	C735Y	probably damaging	Het
Atp9b	T	A	18: 80,822,122 (GRCm39)	T110S	probably benign	Het
Birc6	T	G	17: 74,919,314 (GRCm39)	L221R	probably damaging	Het
Ces1c	A	G	8: 93,854,233 (GRCm39)	F101L	probably benign	Het
Cfap91	A	G	16: 38,141,762 (GRCm39)	V390A	probably damaging	Het
Chsy1	T	C	7: 65,821,750 (GRCm39)	Y662H	probably damaging	Het
Cldn12	A	T	5: 5,557,900 (GRCm39)	F176I	probably benign	Het
Col5a2	A	G	1: 45,450,626 (GRCm39)	S374P	probably benign	Het
Col6a2	A	T	10: 76,439,544 (GRCm39)	V740E	probably damaging	Het
Cpne3	A	T	4: 19,526,336 (GRCm39)	I401K	probably damaging	Het
Cspp1	T	A	1: 10,159,191 (GRCm39)		probably null	Het
Ddn	G	A	15: 98,704,647 (GRCm39)	T215I	possibly damaging	Het
Dync1i1	T	C	6: 5,769,799 (GRCm39)		probably benign	Het
Dync2li1	T	C	17: 84,954,667 (GRCm39)		probably benign	Het
Eif2a	T	A	3: 58,445,005 (GRCm39)	L50*	probably null	Het
Elavl3	G	A	9: 21,929,875 (GRCm39)	A343V	probably damaging	Het
Fastkd1	T	C	2: 69,538,982 (GRCm39)		probably null	Het
Fgf8	C	A	19: 45,730,786 (GRCm39)	V80F	possibly damaging	Het
Fras1	A	T	5: 96,891,046 (GRCm39)	E2858D	probably benign	Het
Fshr	A	T	17: 89,293,529 (GRCm39)	L383Q	probably damaging	Het
Glb1	A	G	9: 114,246,171 (GRCm39)	K74R	probably benign	Het
Gmeb2	T	G	2: 180,897,019 (GRCm39)	M290L	probably benign	Het
Gnptg	A	G	17: 25,454,828 (GRCm39)		probably null	Het
Grik2	A	C	10: 49,008,871 (GRCm39)	S739A	probably damaging	Het
Grk2	T	A	19: 4,337,222 (GRCm39)	Q659L	probably benign	Het
Hdhd5	A	G	6: 120,491,473 (GRCm39)	V210A	probably damaging	Het
Hyal1	C	T	9: 107,455,091 (GRCm39)	L134F	probably damaging	Het
Itgb2	A	T	10: 77,381,987 (GRCm39)	K18N	possibly damaging	Het
Kcnh3	C	A	15: 99,137,796 (GRCm39)	D830E	probably benign	Het
Kcnmb4	T	C	10: 116,309,203 (GRCm39)	D75G	possibly damaging	Het
Kdm4b	A	G	17: 56,707,025 (GRCm39)	Y981C	probably damaging	Het
Klk1b26	C	A	7: 43,665,810 (GRCm39)	D207E	probably benign	Het
Kmt2a	G	T	9: 44,759,563 (GRCm39)	T762N	probably benign	Het
Kmt2d	A	G	15: 98,742,819 (GRCm39)		probably benign	Het
Lama4	T	C	10: 38,964,876 (GRCm39)	S1414P	possibly damaging	Het
Lce1f	C	G	3: 92,626,276 (GRCm39)	C127S	unknown	Het
Map7d1	A	G	4: 126,128,558 (GRCm39)		probably null	Het
Ninl	T	C	2: 150,822,096 (GRCm39)	D2G	possibly damaging	Het
Or2w1b	T	A	13: 21,300,303 (GRCm39)	M147K	probably benign	Het
Or5k3	A	G	16: 58,969,287 (GRCm39)	T25A	probably benign	Het
Or5m11b	C	T	2: 85,806,372 (GRCm39)	P262S	possibly damaging	Het
Or6n1	T	A	1: 173,916,813 (GRCm39)	L69*	probably null	Het
Or8g18	G	C	9: 39,149,547 (GRCm39)	P58A	probably benign	Het
Pax8	A	G	2: 24,319,608 (GRCm39)	Y381H	possibly damaging	Het
Pde7a	T	C	3: 19,314,408 (GRCm39)	I63V	possibly damaging	Het
Pgm3	A	T	9: 86,452,340 (GRCm39)	F40Y	probably benign	Het
Phrf1	G	T	7: 140,836,564 (GRCm39)	D78Y	probably damaging	Het
Plekhg1	C	T	10: 3,890,538 (GRCm39)		probably benign	Het
Prss59	A	T	6: 40,898,652 (GRCm39)	S199T	probably benign	Het
Pum1	T	C	4: 130,446,567 (GRCm39)	S209P	probably damaging	Het
Qtrt2	A	T	16: 43,689,337 (GRCm39)	F220L	probably benign	Het
Rgs9	A	G	11: 109,159,747 (GRCm39)		probably null	Het
Rin3	A	G	12: 102,335,018 (GRCm39)	T230A	unknown	Het
Ros1	A	T	10: 51,974,773 (GRCm39)	V1604E	possibly damaging	Het
Rpp14	A	G	14: 8,090,528 (GRCm38)	M151V	probably benign	Het
Sacs	T	A	14: 61,451,153 (GRCm39)	F4400I	possibly damaging	Het
Scamp1	C	T	13: 94,361,437 (GRCm39)	V148I	probably benign	Het
Slc13a5	A	G	11: 72,141,557 (GRCm39)	C428R	probably damaging	Het
Slc43a2	T	G	11: 75,453,733 (GRCm39)		probably null	Het
Smarcc2	T	A	10: 128,299,741 (GRCm39)	N135K	probably damaging	Het
Snx15	G	C	19: 6,172,094 (GRCm39)	S116R	probably damaging	Het
Stag1	A	G	9: 100,737,885 (GRCm39)	E414G	possibly damaging	Het
Stag1	A	T	9: 100,769,426 (GRCm39)		probably benign	Het
Tmem106a	T	A	11: 101,481,263 (GRCm39)	L257Q	possibly damaging	Het
Tnc	C	T	4: 63,882,991 (GRCm39)	D1968N	probably benign	Het
Trim42	A	G	9: 97,248,138 (GRCm39)	L186P	possibly damaging	Het
Tshb	T	A	3: 102,685,624 (GRCm39)		probably benign	Het
Ttn	T	A	2: 76,584,484 (GRCm39)	D13881V	probably damaging	Het
Uqcrc2	T	C	7: 120,239,506 (GRCm39)	V56A	probably benign	Het
Uty	G	A	Y: 1,197,228 (GRCm39)	T113I	probably damaging	Het
Vps13c	A	G	9: 67,864,787 (GRCm39)	E3032G	probably benign	Het
Wfdc9	T	G	2: 164,493,729 (GRCm39)		probably benign	Het
Zc3h7a	G	A	16: 10,980,520 (GRCm39)	T31I	probably damaging	Het
Zfp462	T	C	4: 55,060,046 (GRCm39)	S1191P	probably damaging	Het

Other mutations in Jam3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00971:Jam3	APN	9	27,013,188 (GRCm39)	missense	probably damaging	1.00
IGL01311:Jam3	APN	9	27,010,019 (GRCm39)	missense	probably damaging	0.99
IGL01729:Jam3	APN	9	27,016,821 (GRCm39)	missense	probably damaging	1.00
IGL03233:Jam3	APN	9	27,013,217 (GRCm39)	missense	probably damaging	1.00
IGL03275:Jam3	APN	9	27,012,545 (GRCm39)	missense	probably damaging	0.99
R0267:Jam3	UTSW	9	27,017,701 (GRCm39)	missense	probably benign	0.01
R0547:Jam3	UTSW	9	27,010,184 (GRCm39)	missense	probably damaging	1.00
R0899:Jam3	UTSW	9	27,010,253 (GRCm39)	missense	probably damaging	1.00
R3926:Jam3	UTSW	9	27,017,701 (GRCm39)	missense	possibly damaging	0.93
R4044:Jam3	UTSW	9	27,013,159 (GRCm39)	critical splice donor site	probably null
R4977:Jam3	UTSW	9	27,009,669 (GRCm39)	missense	probably damaging	0.96
R6527:Jam3	UTSW	9	27,066,640 (GRCm39)	missense	unknown
R6759:Jam3	UTSW	9	27,013,276 (GRCm39)	missense	probably benign	0.09
R7843:Jam3	UTSW	9	27,017,712 (GRCm39)	critical splice acceptor site	probably null
R8088:Jam3	UTSW	9	27,010,156 (GRCm39)	missense	probably benign	0.00
R9688:Jam3	UTSW	9	27,010,204 (GRCm39)	missense	probably benign	0.30
R9700:Jam3	UTSW	9	27,010,183 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACACAACAGCCATCCTGAACATTCTT -3'
(R):5'- GGATACACACAACAGTCACTCTGTTCAA -3'

Sequencing Primer
(F):5'- acacaactatctatactccatctcc -3'
(R):5'- AAGGAAAAGTTGTGGCCTCC -3'

Posted On

2014-04-13