Incidental Mutation 'R1499:Qtrt2'
ID168735
Institutional Source Beutler Lab
Gene Symbol Qtrt2
Ensembl Gene ENSMUSG00000022704
Gene Namequeuine tRNA-ribosyltransferase accessory subunit 2
Synonyms3110012M05Rik, 4930470H18Rik
MMRRC Submission 039550-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R1499 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location43861407-43926809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43868974 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 220 (F220L)
Ref Sequence ENSEMBL: ENSMUSP00000023387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023387]
Predicted Effect probably benign
Transcript: ENSMUST00000023387
AA Change: F220L

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000023387
Gene: ENSMUSG00000022704
AA Change: F220L

DomainStartEndE-ValueType
Pfam:TGT 95 340 7.1e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131360
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143858
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144626
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156568
Meta Mutation Damage Score 0.144 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.4%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of tRNA-guanine transglycosylase. tRNA-guanine transglycosylase is a heterodimeric enzyme complex that plays a critical role in tRNA modification by synthesizing the 7-deazaguanosine queuosine, which is found in tRNAs that code for asparagine, aspartic acid, histidine, and tyrosine. The encoded protein may play a role in the queuosine 5'-monophosphate salvage pathway. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,921,718 S199T probably benign Het
Abca9 T A 11: 110,139,632 Y763F probably benign Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Actl11 A G 9: 107,931,483 T1002A probably damaging Het
Ampd1 T A 3: 103,091,664 N378K probably damaging Het
Arhgap42 A G 9: 9,033,586 probably benign Het
Arhgap6 C A X: 168,796,503 P95T possibly damaging Het
Atg14 T C 14: 47,560,645 N87S probably benign Het
Atp9b C T 18: 80,762,138 C735Y probably damaging Het
Atp9b T A 18: 80,778,907 T110S probably benign Het
Birc6 T G 17: 74,612,319 L221R probably damaging Het
Ces1c A G 8: 93,127,605 F101L probably benign Het
Chsy1 T C 7: 66,172,002 Y662H probably damaging Het
Cldn12 A T 5: 5,507,900 F176I probably benign Het
Col5a2 A G 1: 45,411,466 S374P probably benign Het
Col6a2 A T 10: 76,603,710 V740E probably damaging Het
Cpne3 A T 4: 19,526,336 I401K probably damaging Het
Cspp1 T A 1: 10,088,966 probably null Het
Ddn G A 15: 98,806,766 T215I possibly damaging Het
Dync1i1 T C 6: 5,769,799 probably benign Het
Dync2li1 T C 17: 84,647,239 probably benign Het
Eif2a T A 3: 58,537,584 L50* probably null Het
Elavl3 G A 9: 22,018,579 A343V probably damaging Het
Fastkd1 T C 2: 69,708,638 probably null Het
Fgf8 C A 19: 45,742,347 V80F possibly damaging Het
Fras1 A T 5: 96,743,187 E2858D probably benign Het
Fshr A T 17: 88,986,101 L383Q probably damaging Het
Glb1 A G 9: 114,417,103 K74R probably benign Het
Gmeb2 T G 2: 181,255,226 M290L probably benign Het
Gnptg A G 17: 25,235,854 probably null Het
Grik2 A C 10: 49,132,775 S739A probably damaging Het
Grk2 T A 19: 4,287,194 Q659L probably benign Het
Hdhd5 A G 6: 120,514,512 V210A probably damaging Het
Hyal1 C T 9: 107,577,892 L134F probably damaging Het
Itgb2 A T 10: 77,546,153 K18N possibly damaging Het
Jam3 A T 9: 27,106,405 I29K possibly damaging Het
Kcnh3 C A 15: 99,239,915 D830E probably benign Het
Kcnmb4 T C 10: 116,473,298 D75G possibly damaging Het
Kdm4b A G 17: 56,400,025 Y981C probably damaging Het
Klk1b26 C A 7: 44,016,386 D207E probably benign Het
Kmt2a G T 9: 44,848,266 T762N probably benign Het
Kmt2d A G 15: 98,844,938 probably benign Het
Lama4 T C 10: 39,088,880 S1414P possibly damaging Het
Lce1f C G 3: 92,718,969 C127S unknown Het
Maats1 A G 16: 38,321,400 V390A probably damaging Het
Map7d1 A G 4: 126,234,765 probably null Het
Ninl T C 2: 150,980,176 D2G possibly damaging Het
Olfr1029 C T 2: 85,976,028 P262S possibly damaging Het
Olfr1369-ps1 T A 13: 21,116,133 M147K probably benign Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr195 A G 16: 59,148,924 T25A probably benign Het
Olfr429 T A 1: 174,089,247 L69* probably null Het
Pax8 A G 2: 24,429,596 Y381H possibly damaging Het
Pde7a T C 3: 19,260,244 I63V possibly damaging Het
Pgm3 A T 9: 86,570,287 F40Y probably benign Het
Phrf1 G T 7: 141,256,651 D78Y probably damaging Het
Plekhg1 C T 10: 3,940,538 probably benign Het
Pum1 T C 4: 130,719,256 S209P probably damaging Het
Rgs9 A G 11: 109,268,921 probably null Het
Rin3 A G 12: 102,368,759 T230A unknown Het
Ros1 A T 10: 52,098,677 V1604E possibly damaging Het
Rpp14 A G 14: 8,090,528 M151V probably benign Het
Sacs T A 14: 61,213,704 F4400I possibly damaging Het
Scamp1 C T 13: 94,224,929 V148I probably benign Het
Slc13a5 A G 11: 72,250,731 C428R probably damaging Het
Slc43a2 T G 11: 75,562,907 probably null Het
Smarcc2 T A 10: 128,463,872 N135K probably damaging Het
Snx15 G C 19: 6,122,064 S116R probably damaging Het
Stag1 A G 9: 100,855,832 E414G possibly damaging Het
Stag1 A T 9: 100,887,373 probably benign Het
Tmem106a T A 11: 101,590,437 L257Q possibly damaging Het
Tnc C T 4: 63,964,754 D1968N probably benign Het
Trim42 A G 9: 97,366,085 L186P possibly damaging Het
Tshb T A 3: 102,778,308 probably benign Het
Ttn T A 2: 76,754,140 D13881V probably damaging Het
Uqcrc2 T C 7: 120,640,283 V56A probably benign Het
Uty G A Y: 1,197,228 T113I probably damaging Het
Vps13c A G 9: 67,957,505 E3032G probably benign Het
Wfdc9 T G 2: 164,651,809 probably benign Het
Zc3h7a G A 16: 11,162,656 T31I probably damaging Het
Zfp462 T C 4: 55,060,046 S1191P probably damaging Het
Other mutations in Qtrt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Qtrt2 APN 16 43881189 missense probably damaging 0.99
R1018:Qtrt2 UTSW 16 43878000 missense possibly damaging 0.93
R1258:Qtrt2 UTSW 16 43869083 missense possibly damaging 0.77
R1574:Qtrt2 UTSW 16 43871832 unclassified probably benign
R1830:Qtrt2 UTSW 16 43871655 missense probably damaging 1.00
R2013:Qtrt2 UTSW 16 43869092 missense probably damaging 1.00
R3835:Qtrt2 UTSW 16 43881072 missense probably damaging 1.00
R5199:Qtrt2 UTSW 16 43867425 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GAGTTCCTTGCTCTAGGTGCCAAC -3'
(R):5'- TCACACTGTGGCCTATGCTTGC -3'

Sequencing Primer
(F):5'- TCTAGGTGCCAACATCCCG -3'
(R):5'- TGTTGACCTGGAAGCATCC -3'
Posted On2014-04-13