Incidental Mutation 'R1499:Fgf8'
ID168747
Institutional Source Beutler Lab
Gene Symbol Fgf8
Ensembl Gene ENSMUSG00000025219
Gene Namefibroblast growth factor 8
SynonymsAigf, Fgf-8
MMRRC Submission 039550-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1499 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location45736798-45742915 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 45742347 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 80 (V80F)
Ref Sequence ENSEMBL: ENSMUSP00000026241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026240] [ENSMUST00000026241] [ENSMUST00000111924] [ENSMUST00000111925] [ENSMUST00000111927] [ENSMUST00000111928]
Predicted Effect probably benign
Transcript: ENSMUST00000026240
SMART Domains Protein: ENSMUSP00000026240
Gene: ENSMUSG00000025219

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 49 58 N/A INTRINSIC
FGF 79 207 1.22e-48 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000026241
AA Change: V80F

PolyPhen 2 Score 0.457 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000026241
Gene: ENSMUSG00000025219
AA Change: V80F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
FGF 103 231 1.22e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111924
SMART Domains Protein: ENSMUSP00000107555
Gene: ENSMUSG00000025219

DomainStartEndE-ValueType
FGF 1 103 1.56e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111925
SMART Domains Protein: ENSMUSP00000107556
Gene: ENSMUSG00000025219

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
FGF 68 196 1.22e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111927
SMART Domains Protein: ENSMUSP00000107558
Gene: ENSMUSG00000025219

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
FGF 39 167 1.22e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111928
SMART Domains Protein: ENSMUSP00000107559
Gene: ENSMUSG00000025219

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
FGF 50 178 1.22e-48 SMART
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.4%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein is known to be a factor that supports androgen and anchorage independent growth of mammary tumor cells. Overexpression of this gene has been shown to increase tumor growth and angiogensis. The adult expression of this gene is restricted to testes and ovaries. Temporal and spatial pattern of this gene expression suggests its function as an embryonic epithelial factor. Studies of the mouse and chick homologs revealed roles in midbrain and limb development, organogenesis, embryo gastrulation and left-right axis determination. The alternative splicing of this gene results in four transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations exhibit cardiovascular defects (including abnormal left-right axis determination), impaired limb, thymic, and craniofacial development, and prenatal or early postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,921,718 S199T probably benign Het
Abca9 T A 11: 110,139,632 Y763F probably benign Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Actl11 A G 9: 107,931,483 T1002A probably damaging Het
Ampd1 T A 3: 103,091,664 N378K probably damaging Het
Arhgap42 A G 9: 9,033,586 probably benign Het
Arhgap6 C A X: 168,796,503 P95T possibly damaging Het
Atg14 T C 14: 47,560,645 N87S probably benign Het
Atp9b C T 18: 80,762,138 C735Y probably damaging Het
Atp9b T A 18: 80,778,907 T110S probably benign Het
Birc6 T G 17: 74,612,319 L221R probably damaging Het
Ces1c A G 8: 93,127,605 F101L probably benign Het
Chsy1 T C 7: 66,172,002 Y662H probably damaging Het
Cldn12 A T 5: 5,507,900 F176I probably benign Het
Col5a2 A G 1: 45,411,466 S374P probably benign Het
Col6a2 A T 10: 76,603,710 V740E probably damaging Het
Cpne3 A T 4: 19,526,336 I401K probably damaging Het
Cspp1 T A 1: 10,088,966 probably null Het
Ddn G A 15: 98,806,766 T215I possibly damaging Het
Dync1i1 T C 6: 5,769,799 probably benign Het
Dync2li1 T C 17: 84,647,239 probably benign Het
Eif2a T A 3: 58,537,584 L50* probably null Het
Elavl3 G A 9: 22,018,579 A343V probably damaging Het
Fastkd1 T C 2: 69,708,638 probably null Het
Fras1 A T 5: 96,743,187 E2858D probably benign Het
Fshr A T 17: 88,986,101 L383Q probably damaging Het
Glb1 A G 9: 114,417,103 K74R probably benign Het
Gmeb2 T G 2: 181,255,226 M290L probably benign Het
Gnptg A G 17: 25,235,854 probably null Het
Grik2 A C 10: 49,132,775 S739A probably damaging Het
Grk2 T A 19: 4,287,194 Q659L probably benign Het
Hdhd5 A G 6: 120,514,512 V210A probably damaging Het
Hyal1 C T 9: 107,577,892 L134F probably damaging Het
Itgb2 A T 10: 77,546,153 K18N possibly damaging Het
Jam3 A T 9: 27,106,405 I29K possibly damaging Het
Kcnh3 C A 15: 99,239,915 D830E probably benign Het
Kcnmb4 T C 10: 116,473,298 D75G possibly damaging Het
Kdm4b A G 17: 56,400,025 Y981C probably damaging Het
Klk1b26 C A 7: 44,016,386 D207E probably benign Het
Kmt2a G T 9: 44,848,266 T762N probably benign Het
Kmt2d A G 15: 98,844,938 probably benign Het
Lama4 T C 10: 39,088,880 S1414P possibly damaging Het
Lce1f C G 3: 92,718,969 C127S unknown Het
Maats1 A G 16: 38,321,400 V390A probably damaging Het
Map7d1 A G 4: 126,234,765 probably null Het
Ninl T C 2: 150,980,176 D2G possibly damaging Het
Olfr1029 C T 2: 85,976,028 P262S possibly damaging Het
Olfr1369-ps1 T A 13: 21,116,133 M147K probably benign Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr195 A G 16: 59,148,924 T25A probably benign Het
Olfr429 T A 1: 174,089,247 L69* probably null Het
Pax8 A G 2: 24,429,596 Y381H possibly damaging Het
Pde7a T C 3: 19,260,244 I63V possibly damaging Het
Pgm3 A T 9: 86,570,287 F40Y probably benign Het
Phrf1 G T 7: 141,256,651 D78Y probably damaging Het
Plekhg1 C T 10: 3,940,538 probably benign Het
Pum1 T C 4: 130,719,256 S209P probably damaging Het
Qtrt2 A T 16: 43,868,974 F220L probably benign Het
Rgs9 A G 11: 109,268,921 probably null Het
Rin3 A G 12: 102,368,759 T230A unknown Het
Ros1 A T 10: 52,098,677 V1604E possibly damaging Het
Rpp14 A G 14: 8,090,528 M151V probably benign Het
Sacs T A 14: 61,213,704 F4400I possibly damaging Het
Scamp1 C T 13: 94,224,929 V148I probably benign Het
Slc13a5 A G 11: 72,250,731 C428R probably damaging Het
Slc43a2 T G 11: 75,562,907 probably null Het
Smarcc2 T A 10: 128,463,872 N135K probably damaging Het
Snx15 G C 19: 6,122,064 S116R probably damaging Het
Stag1 A G 9: 100,855,832 E414G possibly damaging Het
Stag1 A T 9: 100,887,373 probably benign Het
Tmem106a T A 11: 101,590,437 L257Q possibly damaging Het
Tnc C T 4: 63,964,754 D1968N probably benign Het
Trim42 A G 9: 97,366,085 L186P possibly damaging Het
Tshb T A 3: 102,778,308 probably benign Het
Ttn T A 2: 76,754,140 D13881V probably damaging Het
Uqcrc2 T C 7: 120,640,283 V56A probably benign Het
Uty G A Y: 1,197,228 T113I probably damaging Het
Vps13c A G 9: 67,957,505 E3032G probably benign Het
Wfdc9 T G 2: 164,651,809 probably benign Het
Zc3h7a G A 16: 11,162,656 T31I probably damaging Het
Zfp462 T C 4: 55,060,046 S1191P probably damaging Het
Other mutations in Fgf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02184:Fgf8 APN 19 45737216 missense probably damaging 1.00
IGL02282:Fgf8 APN 19 45737090 missense possibly damaging 0.72
IGL03083:Fgf8 APN 19 45737228 missense probably damaging 1.00
R1967:Fgf8 UTSW 19 45741568 missense probably damaging 1.00
R4603:Fgf8 UTSW 19 45738153 missense probably benign 0.22
R5621:Fgf8 UTSW 19 45742382 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GGACCCACCTGTTGGGAAACAC -3'
(R):5'- TCTGCCTCCAAGCCCAGGTAAG -3'

Sequencing Primer
(F):5'- TGCTTTTAAGTAGCGAGGCAAC -3'
(R):5'- CAAGCCCAGGTAAGGAGCG -3'
Posted On2014-04-13