Incidental Mutation 'R1495:Serpinb7'
ID168753
Institutional Source Beutler Lab
Gene Symbol Serpinb7
Ensembl Gene ENSMUSG00000067001
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 7
Synonymsmegsin, 4631416M05Rik, ovalbumin
MMRRC Submission 039546-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R1495 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location107399655-107452689 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 107451660 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 266 (K266*)
Ref Sequence ENSEMBL: ENSMUSP00000083896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086690]
Predicted Effect probably null
Transcript: ENSMUST00000086690
AA Change: K266*
SMART Domains Protein: ENSMUSP00000083896
Gene: ENSMUSG00000067001
AA Change: K266*

DomainStartEndE-ValueType
SERPIN 13 380 2.7e-121 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins which function as protease inhibitors. Expression of this gene is upregulated in IgA nephropathy and mutations have been found to cause palmoplantar keratoderma, Nagashima type. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,477,820 N488S probably benign Het
A430105I19Rik T G 2: 118,760,532 K173N probably damaging Het
Acot10 G A 15: 20,665,507 R383C probably damaging Het
Acsm2 A G 7: 119,578,126 D263G probably damaging Het
Adcy2 G T 13: 68,796,535 Q243K probably benign Het
Aggf1 G A 13: 95,356,413 R563* probably null Het
Agt A G 8: 124,559,455 F296S probably damaging Het
Akap14 T C X: 37,163,965 D39G possibly damaging Het
Akt3 T C 1: 177,103,042 M117V probably benign Het
Ankar T C 1: 72,643,291 T1154A probably benign Het
Arvcf T A 16: 18,389,386 L70Q probably damaging Het
Ccdc171 A T 4: 83,681,095 K724* probably null Het
Ccdc91 A G 6: 147,534,172 T85A possibly damaging Het
Cdh3 C T 8: 106,538,997 T224I probably damaging Het
Clstn3 T C 6: 124,449,917 I482V probably benign Het
Cnot9 A G 1: 74,523,600 E176G probably damaging Het
Cntnap4 T G 8: 112,881,763 L1272V possibly damaging Het
Cyb5a T A 18: 84,851,480 M1K probably null Het
Cyp2c23 A G 19: 44,005,508 I473T probably benign Het
Dbil5 T A 11: 76,218,450 M60K probably benign Het
Dgkg A T 16: 22,500,379 L644Q probably damaging Het
Disp3 T C 4: 148,249,825 I1004V probably benign Het
Egf T A 3: 129,713,006 I599F probably damaging Het
Epc2 A G 2: 49,536,663 T145A probably damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Extl3 A T 14: 65,075,867 V622E probably benign Het
Fam227a C T 15: 79,626,245 V403I probably benign Het
Fat2 T A 11: 55,262,673 D3571V probably benign Het
Fcho2 A G 13: 98,749,850 probably null Het
Fras1 A G 5: 96,528,586 N64S possibly damaging Het
Gabbr1 A G 17: 37,055,940 N352S possibly damaging Het
Gabra1 T C 11: 42,154,944 N113S probably damaging Het
Glg1 T C 8: 111,197,675 Y227C probably damaging Het
Gm14851 T A 8: 21,095,201 Q75L probably benign Het
Gm5141 A T 13: 62,774,270 C362S probably damaging Het
Gprc6a T A 10: 51,628,437 T104S probably benign Het
Jph1 A C 1: 17,091,652 V262G probably benign Het
Kank1 C G 19: 25,410,349 T434R probably damaging Het
Kmt2e A G 5: 23,499,327 S1173G possibly damaging Het
Krt75 G A 15: 101,573,873 probably benign Het
Lyzl1 G T 18: 4,181,192 W77L probably null Het
Nipbl T G 15: 8,351,280 N676T probably benign Het
Obscn C T 11: 59,080,160 S2300N probably damaging Het
Olfr459 T G 6: 41,771,903 Y132S probably damaging Het
Osbpl1a T A 18: 12,758,839 M350L probably benign Het
Pecam1 T C 11: 106,688,856 D460G probably damaging Het
Pik3c2a T A 7: 116,388,065 K540N probably benign Het
Prdm12 T A 2: 31,640,193 I32N probably damaging Het
Prkd1 T C 12: 50,366,352 S679G probably damaging Het
Psen2 C T 1: 180,228,854 A393T probably damaging Het
Ptprh T A 7: 4,580,889 T235S probably benign Het
Ranbp3 C T 17: 56,705,527 P182L probably benign Het
Sesn3 T C 9: 14,308,521 S69P probably damaging Het
Slc12a6 T C 2: 112,354,190 M818T probably damaging Het
Slc25a53 C A X: 137,015,335 C4F unknown Het
Snx1 T A 9: 66,096,597 L255F probably benign Het
Sptbn2 T G 19: 4,718,976 S46A possibly damaging Het
Taf4 A G 2: 179,933,027 F595S probably damaging Het
Tec A T 5: 72,786,755 V103E probably damaging Het
Tmco5b T C 2: 113,290,791 S147P possibly damaging Het
Uchl5 C T 1: 143,799,937 T93I possibly damaging Het
Usp14 A T 18: 10,004,994 S225T probably benign Het
Usp45 C A 4: 21,797,385 Q238K possibly damaging Het
Vmn1r6 T A 6: 57,003,073 M218K possibly damaging Het
Zfp84 T A 7: 29,777,303 Y473* probably null Het
Zyg11b G A 4: 108,266,213 P186S probably damaging Het
Other mutations in Serpinb7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Serpinb7 APN 1 107428246 utr 5 prime probably benign
IGL01325:Serpinb7 APN 1 107435380 missense probably damaging 0.98
IGL01595:Serpinb7 APN 1 107428322 missense probably damaging 0.97
IGL01925:Serpinb7 APN 1 107451669 missense probably benign 0.01
IGL02008:Serpinb7 APN 1 107448129 missense possibly damaging 0.51
IGL02206:Serpinb7 APN 1 107435372 missense possibly damaging 0.88
IGL02870:Serpinb7 APN 1 107450287 missense probably damaging 1.00
IGL03010:Serpinb7 APN 1 107452011 utr 3 prime probably benign
R0455:Serpinb7 UTSW 1 107451610 missense possibly damaging 0.91
R0492:Serpinb7 UTSW 1 107452007 makesense probably null
R0664:Serpinb7 UTSW 1 107428307 missense probably damaging 0.98
R1540:Serpinb7 UTSW 1 107428268 missense possibly damaging 0.72
R1789:Serpinb7 UTSW 1 107450273 missense possibly damaging 0.58
R1850:Serpinb7 UTSW 1 107428295 missense probably damaging 1.00
R2962:Serpinb7 UTSW 1 107451726 missense probably benign 0.00
R3151:Serpinb7 UTSW 1 107435351 nonsense probably null
R3439:Serpinb7 UTSW 1 107428351 missense probably damaging 1.00
R4064:Serpinb7 UTSW 1 107446036 missense probably benign 0.09
R4590:Serpinb7 UTSW 1 107451833 missense probably damaging 1.00
R5260:Serpinb7 UTSW 1 107434749 missense possibly damaging 0.74
R5637:Serpinb7 UTSW 1 107428307 missense probably damaging 1.00
R5914:Serpinb7 UTSW 1 107451850 missense probably damaging 1.00
R5992:Serpinb7 UTSW 1 107445996 missense probably damaging 1.00
R6013:Serpinb7 UTSW 1 107450189 missense probably benign
R6317:Serpinb7 UTSW 1 107451706 missense probably damaging 1.00
R6494:Serpinb7 UTSW 1 107435346 nonsense probably null
R7181:Serpinb7 UTSW 1 107450322 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCAGATCCATTTCATGCACTGCTG -3'
(R):5'- TGGACTCAGGAAGCTGCTTTTCAAC -3'

Sequencing Primer
(F):5'- TTCATGCACTGCTGTAGAAAAACC -3'
(R):5'- GAGACCTCTATGAATGACTTGTGC -3'
Posted On2014-04-13