Incidental Mutation 'R1496:Dcaf8'
ID168830
Institutional Source Beutler Lab
Gene Symbol Dcaf8
Ensembl Gene ENSMUSG00000026554
Gene NameDDB1 and CUL4 associated factor 8
SynonymsD1Dau35e, Wdr42a, D1Ucla4, H326
MMRRC Submission 039547-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.493) question?
Stock #R1496 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location172148084-172197005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 172193855 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 538 (M538T)
Ref Sequence ENSEMBL: ENSMUSP00000141732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013842] [ENSMUST00000074144] [ENSMUST00000111247] [ENSMUST00000191689] [ENSMUST00000192704] [ENSMUST00000193638]
Predicted Effect probably benign
Transcript: ENSMUST00000013842
SMART Domains Protein: ENSMUSP00000013842
Gene: ENSMUSG00000013698

DomainStartEndE-ValueType
DED 2 81 2.25e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074144
AA Change: M538T

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000073778
Gene: ENSMUSG00000026554
AA Change: M538T

DomainStartEndE-ValueType
WD40 176 215 3.42e-7 SMART
WD40 218 260 2e-1 SMART
WD40 264 306 1.71e1 SMART
WD40 314 354 5.73e0 SMART
WD40 369 409 1.43e0 SMART
WD40 415 457 2.58e-1 SMART
WD40 460 500 5.91e-2 SMART
low complexity region 544 556 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111247
SMART Domains Protein: ENSMUSP00000106878
Gene: ENSMUSG00000013698

DomainStartEndE-ValueType
DED 2 59 9.4e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125361
Predicted Effect probably benign
Transcript: ENSMUST00000191689
AA Change: M538T

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000141731
Gene: ENSMUSG00000026554
AA Change: M538T

DomainStartEndE-ValueType
WD40 176 215 3.42e-7 SMART
WD40 218 260 2e-1 SMART
WD40 264 306 1.71e1 SMART
WD40 314 354 5.73e0 SMART
WD40 369 409 1.43e0 SMART
WD40 415 457 2.58e-1 SMART
WD40 460 500 5.91e-2 SMART
low complexity region 544 556 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000191891
AA Change: M134T
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192031
Predicted Effect probably benign
Transcript: ENSMUST00000192704
AA Change: M538T

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000141732
Gene: ENSMUSG00000026554
AA Change: M538T

DomainStartEndE-ValueType
WD40 176 215 3.42e-7 SMART
WD40 218 260 2e-1 SMART
WD40 264 306 1.71e1 SMART
WD40 314 354 5.73e0 SMART
WD40 369 409 1.43e0 SMART
WD40 415 457 2.58e-1 SMART
WD40 460 500 5.91e-2 SMART
low complexity region 544 556 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193638
SMART Domains Protein: ENSMUSP00000141836
Gene: ENSMUSG00000026554

DomainStartEndE-ValueType
WD40 176 215 3.42e-7 SMART
WD40 218 260 2e-1 SMART
WD40 264 306 1.71e1 SMART
WD40 314 354 5.73e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195011
Predicted Effect probably benign
Transcript: ENSMUST00000195345
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.9%
Validation Efficiency 98% (94/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat-containing protein that interacts with the Cul4-Ddb1 E3 ligase macromolecular complex. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A G 9: 46,310,254 probably benign Het
4933411K16Rik T C 19: 42,053,050 Y207H probably damaging Het
Abcc1 T A 16: 14,448,434 L832Q probably damaging Het
Acan T A 7: 79,100,804 H1774Q probably benign Het
Adss T C 1: 177,772,194 T275A probably benign Het
Ano5 G A 7: 51,583,775 R595H probably damaging Het
Araf G T X: 20,859,704 R522L probably damaging Het
Arhgef28 C T 13: 97,965,546 V807I possibly damaging Het
Bin1 T C 18: 32,412,704 I103T probably damaging Het
C4b C T 17: 34,740,021 R478Q probably benign Het
Cacna1b G A 2: 24,678,035 P1015S probably benign Het
Capn1 A G 19: 6,007,498 probably null Het
Cep290 A G 10: 100,538,966 Q1358R probably damaging Het
Cfap126 T C 1: 171,125,817 probably benign Het
Chn1 T C 2: 73,679,607 probably benign Het
Cldn8 T C 16: 88,562,401 E212G probably benign Het
Cpb1 T C 3: 20,263,532 N249S probably damaging Het
Cxcr6 A T 9: 123,810,347 I138F probably benign Het
Dab2ip G A 2: 35,718,791 R579H probably damaging Het
Dhrs4 T G 14: 55,487,650 L201V probably damaging Het
Dnah12 C T 14: 26,710,248 A407V probably benign Het
Elavl3 T A 9: 22,026,165 probably benign Het
Elp4 T C 2: 105,832,161 H88R probably benign Het
Ercc3 T C 18: 32,261,297 probably benign Het
Eri1 A G 8: 35,469,181 S329P possibly damaging Het
Erich2 A T 2: 70,512,773 probably benign Het
Esyt1 A G 10: 128,512,428 S864P possibly damaging Het
Fam170b A G 14: 32,835,631 E141G probably damaging Het
Fat1 A G 8: 45,033,390 Y3304C probably damaging Het
Fbn1 T C 2: 125,309,495 T2531A probably benign Het
Fgfr3 T C 5: 33,729,750 V166A probably damaging Het
Glt8d2 T C 10: 82,659,538 D194G probably damaging Het
Gpr89 A G 3: 96,905,210 I5T probably benign Het
Gpx6 A T 13: 21,318,920 H168L probably benign Het
Gusb T C 5: 129,998,544 T307A probably benign Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Ifngr1 A G 10: 19,601,445 D118G probably benign Het
Ipcef1 A T 10: 6,935,173 probably null Het
Kbtbd3 A T 9: 4,330,276 T217S probably benign Het
Kmt5a GAA GA 5: 124,459,885 probably null Het
Lrp1 T C 10: 127,539,011 D4526G probably damaging Het
Lrp1b A T 2: 42,323,662 V46D probably damaging Het
Lsm8 T A 6: 18,849,659 M22K probably benign Het
Map1lc3b C T 8: 121,596,600 R70C possibly damaging Het
Meiob T A 17: 24,813,052 S14T possibly damaging Het
Mkx G T 18: 6,992,330 Y183* probably null Het
Mrs2 T C 13: 25,005,034 Y99C probably benign Het
Mycbpap T C 11: 94,505,561 K151R probably benign Het
Neb T G 2: 52,328,734 Q88P probably damaging Het
Noc4l T A 5: 110,650,078 H319L probably damaging Het
Nt5c2 G A 19: 46,904,978 T122I probably damaging Het
Nuggc A T 14: 65,624,133 N476I probably damaging Het
Obscn T A 11: 59,031,036 H5978L probably benign Het
Oc90 G T 15: 65,876,521 A412D probably damaging Het
Olfr1080 A T 2: 86,553,752 V124E probably damaging Het
Olfr1143 T G 2: 87,802,868 S160A probably benign Het
Olfr1249 A G 2: 89,630,014 S295P possibly damaging Het
Olfr168 T A 16: 19,530,383 D179V possibly damaging Het
Olfr399 A G 11: 74,053,824 *312Q probably null Het
Olfr8 T A 10: 78,955,848 S214R probably benign Het
Pdzrn3 A T 6: 101,150,969 V912E probably benign Het
Phactr1 T A 13: 43,094,990 Y387N probably damaging Het
Picalm T A 7: 90,130,651 C27S probably benign Het
Pkd1l1 T A 11: 8,941,077 I314F possibly damaging Het
Pold2 T C 11: 5,874,175 E210G possibly damaging Het
Ptprz1 C T 6: 23,049,524 probably benign Het
Rac1 G T 5: 143,507,338 A165E probably damaging Het
Rpap3 G T 15: 97,686,483 T360K possibly damaging Het
Scn9a G A 2: 66,526,888 T1012I probably benign Het
Sdad1 A G 5: 92,309,823 I20T possibly damaging Het
Setbp1 T G 18: 78,859,912 K180T probably damaging Het
Sgpl1 T C 10: 61,102,589 N475S probably damaging Het
Shroom3 T C 5: 92,942,834 S1148P possibly damaging Het
Sin3a T A 9: 57,119,158 H1119Q possibly damaging Het
Slc26a7 T A 4: 14,506,489 Y620F probably benign Het
Slc4a1 T C 11: 102,361,171 I36V probably benign Het
Smarca2 C G 19: 26,631,101 P263A possibly damaging Het
Sp100 T C 1: 85,663,521 probably benign Het
Spag6l A G 16: 16,780,614 probably benign Het
Sptbn1 T C 11: 30,121,498 N1491S probably damaging Het
Tbl1xr1 T G 3: 22,190,951 V155G possibly damaging Het
Tmc1 A G 19: 20,868,355 I168T probably damaging Het
Tmem87b G A 2: 128,826,393 probably null Het
Tnfrsf9 T A 4: 150,933,104 probably null Het
Tnni3k T C 3: 154,939,658 D530G probably damaging Het
Vmn1r209 G A 13: 22,805,764 S252F probably damaging Het
Zbtb3 A T 19: 8,803,350 N109I probably damaging Het
Zdhhc17 T G 10: 110,946,210 H541P probably damaging Het
Zfp84 A G 7: 29,776,614 I244V possibly damaging Het
Zyx A G 6: 42,356,312 Y393C probably damaging Het
Other mutations in Dcaf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03163:Dcaf8 APN 1 172172908 missense probably damaging 1.00
FR4976:Dcaf8 UTSW 1 172172856 missense probably damaging 1.00
R0329:Dcaf8 UTSW 1 172187411 missense probably benign 0.42
R0458:Dcaf8 UTSW 1 172174043 missense probably benign 0.00
R0729:Dcaf8 UTSW 1 172172654 missense probably benign
R0731:Dcaf8 UTSW 1 172172509 missense possibly damaging 0.66
R1389:Dcaf8 UTSW 1 172174052 missense probably benign 0.00
R1719:Dcaf8 UTSW 1 172175495 missense probably damaging 0.96
R1856:Dcaf8 UTSW 1 172175553 missense probably damaging 1.00
R2342:Dcaf8 UTSW 1 172186361 missense possibly damaging 0.48
R2512:Dcaf8 UTSW 1 172189035 missense possibly damaging 0.95
R4163:Dcaf8 UTSW 1 172192570 missense probably damaging 1.00
R4546:Dcaf8 UTSW 1 172179893 splice site probably benign
R4880:Dcaf8 UTSW 1 172187489 intron probably benign
R5092:Dcaf8 UTSW 1 172186909 missense probably benign 0.02
R5622:Dcaf8 UTSW 1 172186398 intron probably benign
R5734:Dcaf8 UTSW 1 172172911 missense possibly damaging 0.65
R6245:Dcaf8 UTSW 1 172165867 start codon destroyed probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCAAACAGCAACACCAGACTCTTTGATG -3'
(R):5'- TCCAGCCACTGCAACTATAAAGCTAC -3'

Sequencing Primer
(F):5'- CCAGACTCTTTGATGAAACTCAG -3'
(R):5'- TTGCTCTAATGGGGATAAAGGC -3'
Posted On2014-04-13