Incidental Mutation 'R1496:Tnfrsf9'
ID168851
Institutional Source Beutler Lab
Gene Symbol Tnfrsf9
Ensembl Gene ENSMUSG00000028965
Gene Nametumor necrosis factor receptor superfamily, member 9
SynonymsA930040I11Rik, Cd137, Ly63, ILA, CDw137, 4-1BB
MMRRC Submission 039547-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R1496 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location150914562-150946102 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 150933104 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030808] [ENSMUST00000060901] [ENSMUST00000105671] [ENSMUST00000105672] [ENSMUST00000116257] [ENSMUST00000126707] [ENSMUST00000135169] [ENSMUST00000139826] [ENSMUST00000169423]
Predicted Effect probably null
Transcript: ENSMUST00000030808
SMART Domains Protein: ENSMUSP00000030808
Gene: ENSMUSG00000028965

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 47 85 2.36e-6 SMART
TNFR 119 158 1.11e-2 SMART
transmembrane domain 189 211 N/A INTRINSIC
low complexity region 246 253 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000060901
SMART Domains Protein: ENSMUSP00000059684
Gene: ENSMUSG00000028965

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 47 85 1.1e-8 SMART
TNFR 119 158 5.4e-5 SMART
low complexity region 201 208 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105671
SMART Domains Protein: ENSMUSP00000101296
Gene: ENSMUSG00000028965

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 47 85 2.36e-6 SMART
TNFR 119 158 1.11e-2 SMART
transmembrane domain 189 211 N/A INTRINSIC
low complexity region 246 253 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105672
SMART Domains Protein: ENSMUSP00000101297
Gene: ENSMUSG00000028965

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 47 85 1.1e-8 SMART
TNFR 119 158 5.4e-5 SMART
low complexity region 201 208 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000116257
SMART Domains Protein: ENSMUSP00000111961
Gene: ENSMUSG00000028965

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 47 85 2.36e-6 SMART
TNFR 119 158 1.11e-2 SMART
transmembrane domain 189 211 N/A INTRINSIC
low complexity region 246 253 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000126707
SMART Domains Protein: ENSMUSP00000122917
Gene: ENSMUSG00000028965

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 47 85 2.36e-6 SMART
TNFR 119 158 1.11e-2 SMART
transmembrane domain 189 211 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000135169
SMART Domains Protein: ENSMUSP00000120761
Gene: ENSMUSG00000028965

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 47 85 2.36e-6 SMART
TNFR 119 158 1.11e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000139826
SMART Domains Protein: ENSMUSP00000117860
Gene: ENSMUSG00000028965

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 47 85 2.36e-6 SMART
TNFR 119 158 1.11e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146133
Predicted Effect probably benign
Transcript: ENSMUST00000169423
SMART Domains Protein: ENSMUSP00000127916
Gene: ENSMUSG00000014592

DomainStartEndE-ValueType
CG-1 67 183 1.39e-91 SMART
low complexity region 550 583 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Pfam:TIG 874 954 3.1e-11 PFAM
low complexity region 997 1030 N/A INTRINSIC
ANK 1066 1095 1.7e2 SMART
ANK 1111 1141 4.73e2 SMART
low complexity region 1301 1319 N/A INTRINSIC
IQ 1548 1564 2.38e2 SMART
IQ 1578 1600 5.42e0 SMART
Meta Mutation Damage Score 0.452 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.9%
Validation Efficiency 98% (94/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor contributes to the clonal expansion, survival, and development of T cells. It can also induce proliferation in peripheral monocytes, enhance T cell apoptosis induced by TCR/CD3 triggered activation, and regulate CD28 co-stimulation to promote Th1 cell responses. The expression of this receptor is induced by lymphocyte activation. TRAF adaptor proteins have been shown to bind to this receptor and transduce the signals leading to activation of NF-kappaB. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in enhanced T cell proliferation, decreased B cell IgG production, decreased cytotoxic T cell activity, and increased numbers of erythrocytes, granulocyte macrophages, and multipotential progenitor cells in the bone marrow, blood, and spleen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A G 9: 46,310,254 probably benign Het
4933411K16Rik T C 19: 42,053,050 Y207H probably damaging Het
Abcc1 T A 16: 14,448,434 L832Q probably damaging Het
Acan T A 7: 79,100,804 H1774Q probably benign Het
Adss T C 1: 177,772,194 T275A probably benign Het
Ano5 G A 7: 51,583,775 R595H probably damaging Het
Araf G T X: 20,859,704 R522L probably damaging Het
Arhgef28 C T 13: 97,965,546 V807I possibly damaging Het
Bin1 T C 18: 32,412,704 I103T probably damaging Het
C4b C T 17: 34,740,021 R478Q probably benign Het
Cacna1b G A 2: 24,678,035 P1015S probably benign Het
Capn1 A G 19: 6,007,498 probably null Het
Cep290 A G 10: 100,538,966 Q1358R probably damaging Het
Cfap126 T C 1: 171,125,817 probably benign Het
Chn1 T C 2: 73,679,607 probably benign Het
Cldn8 T C 16: 88,562,401 E212G probably benign Het
Cpb1 T C 3: 20,263,532 N249S probably damaging Het
Cxcr6 A T 9: 123,810,347 I138F probably benign Het
Dab2ip G A 2: 35,718,791 R579H probably damaging Het
Dcaf8 T C 1: 172,193,855 M538T probably benign Het
Dhrs4 T G 14: 55,487,650 L201V probably damaging Het
Dnah12 C T 14: 26,710,248 A407V probably benign Het
Elavl3 T A 9: 22,026,165 probably benign Het
Elp4 T C 2: 105,832,161 H88R probably benign Het
Ercc3 T C 18: 32,261,297 probably benign Het
Eri1 A G 8: 35,469,181 S329P possibly damaging Het
Erich2 A T 2: 70,512,773 probably benign Het
Esyt1 A G 10: 128,512,428 S864P possibly damaging Het
Fam170b A G 14: 32,835,631 E141G probably damaging Het
Fat1 A G 8: 45,033,390 Y3304C probably damaging Het
Fbn1 T C 2: 125,309,495 T2531A probably benign Het
Fgfr3 T C 5: 33,729,750 V166A probably damaging Het
Glt8d2 T C 10: 82,659,538 D194G probably damaging Het
Gpr89 A G 3: 96,905,210 I5T probably benign Het
Gpx6 A T 13: 21,318,920 H168L probably benign Het
Gusb T C 5: 129,998,544 T307A probably benign Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Ifngr1 A G 10: 19,601,445 D118G probably benign Het
Ipcef1 A T 10: 6,935,173 probably null Het
Kbtbd3 A T 9: 4,330,276 T217S probably benign Het
Kmt5a GAA GA 5: 124,459,885 probably null Het
Lrp1 T C 10: 127,539,011 D4526G probably damaging Het
Lrp1b A T 2: 42,323,662 V46D probably damaging Het
Lsm8 T A 6: 18,849,659 M22K probably benign Het
Map1lc3b C T 8: 121,596,600 R70C possibly damaging Het
Meiob T A 17: 24,813,052 S14T possibly damaging Het
Mkx G T 18: 6,992,330 Y183* probably null Het
Mrs2 T C 13: 25,005,034 Y99C probably benign Het
Mycbpap T C 11: 94,505,561 K151R probably benign Het
Neb T G 2: 52,328,734 Q88P probably damaging Het
Noc4l T A 5: 110,650,078 H319L probably damaging Het
Nt5c2 G A 19: 46,904,978 T122I probably damaging Het
Nuggc A T 14: 65,624,133 N476I probably damaging Het
Obscn T A 11: 59,031,036 H5978L probably benign Het
Oc90 G T 15: 65,876,521 A412D probably damaging Het
Olfr1080 A T 2: 86,553,752 V124E probably damaging Het
Olfr1143 T G 2: 87,802,868 S160A probably benign Het
Olfr1249 A G 2: 89,630,014 S295P possibly damaging Het
Olfr168 T A 16: 19,530,383 D179V possibly damaging Het
Olfr399 A G 11: 74,053,824 *312Q probably null Het
Olfr8 T A 10: 78,955,848 S214R probably benign Het
Pdzrn3 A T 6: 101,150,969 V912E probably benign Het
Phactr1 T A 13: 43,094,990 Y387N probably damaging Het
Picalm T A 7: 90,130,651 C27S probably benign Het
Pkd1l1 T A 11: 8,941,077 I314F possibly damaging Het
Pold2 T C 11: 5,874,175 E210G possibly damaging Het
Ptprz1 C T 6: 23,049,524 probably benign Het
Rac1 G T 5: 143,507,338 A165E probably damaging Het
Rpap3 G T 15: 97,686,483 T360K possibly damaging Het
Scn9a G A 2: 66,526,888 T1012I probably benign Het
Sdad1 A G 5: 92,309,823 I20T possibly damaging Het
Setbp1 T G 18: 78,859,912 K180T probably damaging Het
Sgpl1 T C 10: 61,102,589 N475S probably damaging Het
Shroom3 T C 5: 92,942,834 S1148P possibly damaging Het
Sin3a T A 9: 57,119,158 H1119Q possibly damaging Het
Slc26a7 T A 4: 14,506,489 Y620F probably benign Het
Slc4a1 T C 11: 102,361,171 I36V probably benign Het
Smarca2 C G 19: 26,631,101 P263A possibly damaging Het
Sp100 T C 1: 85,663,521 probably benign Het
Spag6l A G 16: 16,780,614 probably benign Het
Sptbn1 T C 11: 30,121,498 N1491S probably damaging Het
Tbl1xr1 T G 3: 22,190,951 V155G possibly damaging Het
Tmc1 A G 19: 20,868,355 I168T probably damaging Het
Tmem87b G A 2: 128,826,393 probably null Het
Tnni3k T C 3: 154,939,658 D530G probably damaging Het
Vmn1r209 G A 13: 22,805,764 S252F probably damaging Het
Zbtb3 A T 19: 8,803,350 N109I probably damaging Het
Zdhhc17 T G 10: 110,946,210 H541P probably damaging Het
Zfp84 A G 7: 29,776,614 I244V possibly damaging Het
Zyx A G 6: 42,356,312 Y393C probably damaging Het
Other mutations in Tnfrsf9
AlleleSourceChrCoordTypePredicted EffectPPH Score
asilomar UTSW 4 150929874 missense probably benign 0.01
FR4304:Tnfrsf9 UTSW 4 150934395 intron probably benign
FR4342:Tnfrsf9 UTSW 4 150934394 intron probably benign
R1870:Tnfrsf9 UTSW 4 150934347 nonsense probably null
R5596:Tnfrsf9 UTSW 4 150929874 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGACCCGAGATAGTTGCTCATCACC -3'
(R):5'- GGTAGCATCAAACCTCACCTGGAC -3'

Sequencing Primer
(F):5'- TAGTTGCTCATCACCAGGAAAG -3'
(R):5'- actgcctgtgtccctcc -3'
Posted On2014-04-13