Incidental Mutation 'R1496:Dnah12'
ID168896
Institutional Source Beutler Lab
Gene Symbol Dnah12
Ensembl Gene ENSMUSG00000021879
Gene Namedynein, axonemal, heavy chain 12
SynonymsDHC3, Hdhc3, HL-19, Dnahc7l, 4921531P07Rik, LOC380889, DLP12, HL19, Dnahc12
MMRRC Submission 039547-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.553) question?
Stock #R1496 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location26693274-26891703 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 26710248 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 407 (A407V)
Ref Sequence ENSEMBL: ENSMUSP00000022433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022433]
Predicted Effect probably benign
Transcript: ENSMUST00000022433
AA Change: A407V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022433
Gene: ENSMUSG00000021879
AA Change: A407V

DomainStartEndE-ValueType
low complexity region 127 140 N/A INTRINSIC
coiled coil region 588 666 N/A INTRINSIC
Pfam:DHC_N2 676 1113 1.1e-147 PFAM
AAA 1268 1407 1.15e0 SMART
Pfam:AAA_5 1552 1695 1.5e-7 PFAM
Blast:AAA 1709 1827 2e-24 BLAST
Blast:AAA 1848 1898 1e-16 BLAST
AAA 1903 2051 5.42e-4 SMART
Pfam:AAA_8 2238 2316 2e-18 PFAM
Meta Mutation Damage Score 0.024 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.9%
Validation Efficiency 98% (94/96)
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A G 9: 46,310,254 probably benign Het
4933411K16Rik T C 19: 42,053,050 Y207H probably damaging Het
Abcc1 T A 16: 14,448,434 L832Q probably damaging Het
Acan T A 7: 79,100,804 H1774Q probably benign Het
Adss T C 1: 177,772,194 T275A probably benign Het
Ano5 G A 7: 51,583,775 R595H probably damaging Het
Araf G T X: 20,859,704 R522L probably damaging Het
Arhgef28 C T 13: 97,965,546 V807I possibly damaging Het
Bin1 T C 18: 32,412,704 I103T probably damaging Het
C4b C T 17: 34,740,021 R478Q probably benign Het
Cacna1b G A 2: 24,678,035 P1015S probably benign Het
Capn1 A G 19: 6,007,498 probably null Het
Cep290 A G 10: 100,538,966 Q1358R probably damaging Het
Cfap126 T C 1: 171,125,817 probably benign Het
Chn1 T C 2: 73,679,607 probably benign Het
Cldn8 T C 16: 88,562,401 E212G probably benign Het
Cpb1 T C 3: 20,263,532 N249S probably damaging Het
Cxcr6 A T 9: 123,810,347 I138F probably benign Het
Dab2ip G A 2: 35,718,791 R579H probably damaging Het
Dcaf8 T C 1: 172,193,855 M538T probably benign Het
Dhrs4 T G 14: 55,487,650 L201V probably damaging Het
Elavl3 T A 9: 22,026,165 probably benign Het
Elp4 T C 2: 105,832,161 H88R probably benign Het
Ercc3 T C 18: 32,261,297 probably benign Het
Eri1 A G 8: 35,469,181 S329P possibly damaging Het
Erich2 A T 2: 70,512,773 probably benign Het
Esyt1 A G 10: 128,512,428 S864P possibly damaging Het
Fam170b A G 14: 32,835,631 E141G probably damaging Het
Fat1 A G 8: 45,033,390 Y3304C probably damaging Het
Fbn1 T C 2: 125,309,495 T2531A probably benign Het
Fgfr3 T C 5: 33,729,750 V166A probably damaging Het
Glt8d2 T C 10: 82,659,538 D194G probably damaging Het
Gpr89 A G 3: 96,905,210 I5T probably benign Het
Gpx6 A T 13: 21,318,920 H168L probably benign Het
Gusb T C 5: 129,998,544 T307A probably benign Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Ifngr1 A G 10: 19,601,445 D118G probably benign Het
Ipcef1 A T 10: 6,935,173 probably null Het
Kbtbd3 A T 9: 4,330,276 T217S probably benign Het
Kmt5a GAA GA 5: 124,459,885 probably null Het
Lrp1 T C 10: 127,539,011 D4526G probably damaging Het
Lrp1b A T 2: 42,323,662 V46D probably damaging Het
Lsm8 T A 6: 18,849,659 M22K probably benign Het
Map1lc3b C T 8: 121,596,600 R70C possibly damaging Het
Meiob T A 17: 24,813,052 S14T possibly damaging Het
Mkx G T 18: 6,992,330 Y183* probably null Het
Mrs2 T C 13: 25,005,034 Y99C probably benign Het
Mycbpap T C 11: 94,505,561 K151R probably benign Het
Neb T G 2: 52,328,734 Q88P probably damaging Het
Noc4l T A 5: 110,650,078 H319L probably damaging Het
Nt5c2 G A 19: 46,904,978 T122I probably damaging Het
Nuggc A T 14: 65,624,133 N476I probably damaging Het
Obscn T A 11: 59,031,036 H5978L probably benign Het
Oc90 G T 15: 65,876,521 A412D probably damaging Het
Olfr1080 A T 2: 86,553,752 V124E probably damaging Het
Olfr1143 T G 2: 87,802,868 S160A probably benign Het
Olfr1249 A G 2: 89,630,014 S295P possibly damaging Het
Olfr168 T A 16: 19,530,383 D179V possibly damaging Het
Olfr399 A G 11: 74,053,824 *312Q probably null Het
Olfr8 T A 10: 78,955,848 S214R probably benign Het
Pdzrn3 A T 6: 101,150,969 V912E probably benign Het
Phactr1 T A 13: 43,094,990 Y387N probably damaging Het
Picalm T A 7: 90,130,651 C27S probably benign Het
Pkd1l1 T A 11: 8,941,077 I314F possibly damaging Het
Pold2 T C 11: 5,874,175 E210G possibly damaging Het
Ptprz1 C T 6: 23,049,524 probably benign Het
Rac1 G T 5: 143,507,338 A165E probably damaging Het
Rpap3 G T 15: 97,686,483 T360K possibly damaging Het
Scn9a G A 2: 66,526,888 T1012I probably benign Het
Sdad1 A G 5: 92,309,823 I20T possibly damaging Het
Setbp1 T G 18: 78,859,912 K180T probably damaging Het
Sgpl1 T C 10: 61,102,589 N475S probably damaging Het
Shroom3 T C 5: 92,942,834 S1148P possibly damaging Het
Sin3a T A 9: 57,119,158 H1119Q possibly damaging Het
Slc26a7 T A 4: 14,506,489 Y620F probably benign Het
Slc4a1 T C 11: 102,361,171 I36V probably benign Het
Smarca2 C G 19: 26,631,101 P263A possibly damaging Het
Sp100 T C 1: 85,663,521 probably benign Het
Spag6l A G 16: 16,780,614 probably benign Het
Sptbn1 T C 11: 30,121,498 N1491S probably damaging Het
Tbl1xr1 T G 3: 22,190,951 V155G possibly damaging Het
Tmc1 A G 19: 20,868,355 I168T probably damaging Het
Tmem87b G A 2: 128,826,393 probably null Het
Tnfrsf9 T A 4: 150,933,104 probably null Het
Tnni3k T C 3: 154,939,658 D530G probably damaging Het
Vmn1r209 G A 13: 22,805,764 S252F probably damaging Het
Zbtb3 A T 19: 8,803,350 N109I probably damaging Het
Zdhhc17 T G 10: 110,946,210 H541P probably damaging Het
Zfp84 A G 7: 29,776,614 I244V possibly damaging Het
Zyx A G 6: 42,356,312 Y393C probably damaging Het
Other mutations in Dnah12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Dnah12 APN 14 26771005 missense probably damaging 1.00
IGL01602:Dnah12 APN 14 26710275 splice site probably benign
IGL01681:Dnah12 APN 14 26722160 missense probably benign
IGL02082:Dnah12 APN 14 26707162 missense possibly damaging 0.79
IGL02140:Dnah12 APN 14 26716577 missense probably benign 0.20
IGL02170:Dnah12 APN 14 26773112 missense probably damaging 0.99
IGL02174:Dnah12 APN 14 26706917 missense probably benign 0.00
IGL02367:Dnah12 APN 14 26709161 missense probably benign 0.30
IGL02418:Dnah12 APN 14 26773722 missense probably damaging 1.00
IGL03039:Dnah12 APN 14 26724512 missense probably benign 0.02
IGL03066:Dnah12 APN 14 26697398 missense probably benign 0.06
F5770:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
FR4304:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4340:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4342:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4589:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
IGL03055:Dnah12 UTSW 14 26872740 missense probably damaging 1.00
LCD18:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
R0003:Dnah12 UTSW 14 26772644 missense probably damaging 1.00
R0110:Dnah12 UTSW 14 26798899 missense probably damaging 1.00
R0302:Dnah12 UTSW 14 26799999 missense probably damaging 1.00
R0355:Dnah12 UTSW 14 26706117 intron probably null
R0364:Dnah12 UTSW 14 26724473 missense probably benign 0.10
R0469:Dnah12 UTSW 14 26798899 missense probably damaging 1.00
R0558:Dnah12 UTSW 14 26709310 missense probably benign 0.00
R0709:Dnah12 UTSW 14 26884265 splice site probably benign
R0734:Dnah12 UTSW 14 26800013 missense probably benign 0.00
R1273:Dnah12 UTSW 14 26739220 nonsense probably null
R1503:Dnah12 UTSW 14 26773692 missense probably damaging 1.00
R1535:Dnah12 UTSW 14 26816322 missense possibly damaging 0.91
R1608:Dnah12 UTSW 14 26766190 missense probably damaging 1.00
R1682:Dnah12 UTSW 14 26778883 missense possibly damaging 0.71
R1758:Dnah12 UTSW 14 26766114 missense probably benign 0.02
R1826:Dnah12 UTSW 14 26711019 missense probably benign 0.01
R1829:Dnah12 UTSW 14 26773023 missense probably damaging 1.00
R1829:Dnah12 UTSW 14 26800075 missense probably damaging 1.00
R1862:Dnah12 UTSW 14 26697398 missense probably benign 0.06
R1862:Dnah12 UTSW 14 26709257 missense probably benign 0.30
R1913:Dnah12 UTSW 14 26792264 splice site probably null
R1933:Dnah12 UTSW 14 26734495 missense probably damaging 0.98
R2006:Dnah12 UTSW 14 26814459 missense possibly damaging 0.95
R2045:Dnah12 UTSW 14 26781528 missense probably null 1.00
R2113:Dnah12 UTSW 14 26766141 missense probably damaging 1.00
R2125:Dnah12 UTSW 14 26724458 nonsense probably null
R2126:Dnah12 UTSW 14 26724458 nonsense probably null
R2207:Dnah12 UTSW 14 26781787 missense probably damaging 0.99
R2213:Dnah12 UTSW 14 26739330 missense probably benign 0.06
R2511:Dnah12 UTSW 14 26769950 missense possibly damaging 0.65
R2875:Dnah12 UTSW 14 26693470 missense probably benign 0.04
R2875:Dnah12 UTSW 14 26876950 missense probably benign 0.05
R3551:Dnah12 UTSW 14 26770972 missense probably benign 0.01
R3713:Dnah12 UTSW 14 26812790 missense probably benign
R3729:Dnah12 UTSW 14 26706065 missense probably benign 0.02
R3799:Dnah12 UTSW 14 26770923 missense probably damaging 1.00
R3846:Dnah12 UTSW 14 26710211 missense probably benign 0.00
R3892:Dnah12 UTSW 14 26856616 missense probably benign 0.03
R3921:Dnah12 UTSW 14 26771051 missense probably damaging 1.00
R3940:Dnah12 UTSW 14 26723599 missense probably benign
R4065:Dnah12 UTSW 14 26770448 missense probably benign 0.02
R4113:Dnah12 UTSW 14 26693567 missense probably damaging 0.98
R4249:Dnah12 UTSW 14 26709186 missense possibly damaging 0.70
R4259:Dnah12 UTSW 14 26798926 missense probably benign 0.01
R4260:Dnah12 UTSW 14 26798926 missense probably benign 0.01
R4348:Dnah12 UTSW 14 26814541 missense possibly damaging 0.94
R4457:Dnah12 UTSW 14 26815507 missense probably damaging 1.00
R4490:Dnah12 UTSW 14 26734603 missense possibly damaging 0.67
R4491:Dnah12 UTSW 14 26734603 missense possibly damaging 0.67
R4494:Dnah12 UTSW 14 26871855 missense probably damaging 0.99
R4523:Dnah12 UTSW 14 26770022 missense probably damaging 0.97
R4523:Dnah12 UTSW 14 26876958 missense possibly damaging 0.83
R4546:Dnah12 UTSW 14 26773014 missense probably damaging 1.00
R4584:Dnah12 UTSW 14 26772594 missense probably damaging 1.00
R4624:Dnah12 UTSW 14 26735758 missense possibly damaging 0.82
R4689:Dnah12 UTSW 14 26706839 missense probably benign 0.00
R4727:Dnah12 UTSW 14 26872317 missense probably damaging 1.00
R4732:Dnah12 UTSW 14 26781784 missense probably damaging 1.00
R4733:Dnah12 UTSW 14 26781784 missense probably damaging 1.00
R4851:Dnah12 UTSW 14 26716629 nonsense probably null
R4879:Dnah12 UTSW 14 26718046 critical splice donor site probably null
R4893:Dnah12 UTSW 14 26710170 missense possibly damaging 0.66
R4915:Dnah12 UTSW 14 26734570 missense probably damaging 1.00
R4927:Dnah12 UTSW 14 26861805 nonsense probably null
R4939:Dnah12 UTSW 14 26891524 missense probably damaging 1.00
R4962:Dnah12 UTSW 14 26716700 missense probably benign 0.00
R5011:Dnah12 UTSW 14 26710171 missense probably benign 0.03
R5013:Dnah12 UTSW 14 26710171 missense probably benign 0.03
R5043:Dnah12 UTSW 14 26884190 missense probably damaging 1.00
R5049:Dnah12 UTSW 14 26735697 missense probably benign 0.09
R5122:Dnah12 UTSW 14 26718000 missense probably benign 0.00
R5135:Dnah12 UTSW 14 26770477 missense probably damaging 0.99
R5149:Dnah12 UTSW 14 26850926 nonsense probably null
R5154:Dnah12 UTSW 14 26849363 missense probably benign 0.12
R5206:Dnah12 UTSW 14 26769985 missense probably damaging 1.00
R5307:Dnah12 UTSW 14 26693486 missense possibly damaging 0.49
R5330:Dnah12 UTSW 14 26773830 missense probably damaging 1.00
R5335:Dnah12 UTSW 14 26879738 missense probably damaging 1.00
R5339:Dnah12 UTSW 14 26814537 missense possibly damaging 0.83
R5354:Dnah12 UTSW 14 26774342 splice site probably null
R5389:Dnah12 UTSW 14 26735749 missense probably damaging 1.00
R5434:Dnah12 UTSW 14 26859299 missense probably damaging 1.00
R5466:Dnah12 UTSW 14 26771050 missense probably damaging 1.00
R5655:Dnah12 UTSW 14 26710269 missense probably benign 0.01
R5681:Dnah12 UTSW 14 26815495 missense probably benign 0.32
R5824:Dnah12 UTSW 14 26770518 critical splice donor site probably null
R5863:Dnah12 UTSW 14 26854921 missense probably damaging 1.00
R5890:Dnah12 UTSW 14 26706884 missense probably benign 0.09
R5912:Dnah12 UTSW 14 26770008 nonsense probably null
R5916:Dnah12 UTSW 14 26706918 missense possibly damaging 0.92
R5941:Dnah12 UTSW 14 26706867 missense probably benign 0.00
R5987:Dnah12 UTSW 14 26886871 missense possibly damaging 0.54
R5992:Dnah12 UTSW 14 26697341 missense probably benign 0.04
R6132:Dnah12 UTSW 14 26717911 missense probably damaging 1.00
R6136:Dnah12 UTSW 14 26875270 missense probably damaging 0.99
R6158:Dnah12 UTSW 14 26773685 missense possibly damaging 0.95
R6183:Dnah12 UTSW 14 26861769 missense probably damaging 1.00
R6191:Dnah12 UTSW 14 26710257 missense probably benign 0.03
R6235:Dnah12 UTSW 14 26854804 missense probably damaging 1.00
R6277:Dnah12 UTSW 14 26770482 missense probably damaging 1.00
R6332:Dnah12 UTSW 14 26717974 missense probably damaging 0.99
R6334:Dnah12 UTSW 14 26706834 missense possibly damaging 0.51
R6443:Dnah12 UTSW 14 26878051 missense probably benign 0.06
R6480:Dnah12 UTSW 14 26872455 missense probably damaging 1.00
R6530:Dnah12 UTSW 14 26735710 missense probably damaging 1.00
R6678:Dnah12 UTSW 14 26735692 missense probably damaging 1.00
R6709:Dnah12 UTSW 14 26872749 missense probably damaging 1.00
R6724:Dnah12 UTSW 14 26796223 missense probably benign 0.02
R6745:Dnah12 UTSW 14 26707228 missense probably damaging 0.99
R6788:Dnah12 UTSW 14 26801513 missense probably damaging 0.99
R6894:Dnah12 UTSW 14 26735749 missense probably damaging 1.00
R6912:Dnah12 UTSW 14 26878079 missense probably damaging 1.00
V7580:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
V7581:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
X0018:Dnah12 UTSW 14 26814480 missense probably damaging 1.00
X0027:Dnah12 UTSW 14 26816288 missense probably damaging 1.00
X0065:Dnah12 UTSW 14 26814645 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGGTCTTTTCTTGGACCACAGAAATGT -3'
(R):5'- GAGACTAGAACTGTCTGCCTAGACACA -3'

Sequencing Primer
(F):5'- TGGACCACAGAAATGTAAAGAAAATG -3'
(R):5'- TGATATTTACCCTGCAACCCAGATG -3'
Posted On2014-04-13