Incidental Mutation 'R1496:Oc90'
ID168901
Institutional Source Beutler Lab
Gene Symbol Oc90
Ensembl Gene ENSMUSG00000015001
Gene Nameotoconin 90
SynonymsPla2ll, PLA2L, Ocn-95
MMRRC Submission 039547-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R1496 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location65876053-65912397 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 65876521 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 412 (A412D)
Ref Sequence ENSEMBL: ENSMUSP00000062865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015146] [ENSMUST00000060522] [ENSMUST00000079776]
Predicted Effect probably benign
Transcript: ENSMUST00000015146
SMART Domains Protein: ENSMUSP00000015146
Gene: ENSMUSG00000015002

DomainStartEndE-ValueType
SCOP:d1gw5a_ 226 584 5e-4 SMART
low complexity region 709 720 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000060522
AA Change: A412D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062865
Gene: ENSMUSG00000015001
AA Change: A412D

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PA2c 74 190 1.75e-15 SMART
PA2c 314 429 3.5e-15 SMART
low complexity region 446 458 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000079776
AA Change: A380D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078709
Gene: ENSMUSG00000015001
AA Change: A380D

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PA2c 74 190 1.75e-15 SMART
PA2c 282 397 3.5e-15 SMART
low complexity region 414 426 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000135442
AA Change: A256D
SMART Domains Protein: ENSMUSP00000114254
Gene: ENSMUSG00000015001
AA Change: A256D

DomainStartEndE-ValueType
internal_repeat_1 2 67 2.77e-7 PROSPERO
PA2c 159 274 3.5e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147776
SMART Domains Protein: ENSMUSP00000118937
Gene: ENSMUSG00000015001

DomainStartEndE-ValueType
PA2c 122 220 8.1e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000156996
AA Change: A380D
SMART Domains Protein: ENSMUSP00000121227
Gene: ENSMUSG00000015001
AA Change: A380D

DomainStartEndE-ValueType
PA2c 58 174 1.75e-15 SMART
PA2c 283 398 3.5e-15 SMART
low complexity region 415 427 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
Meta Mutation Damage Score 0.032 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.9%
Validation Efficiency 98% (94/96)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit reduced, enlarged, and loose otoliths, and thin cupula, saccule, utricle and tectorial membranes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A G 9: 46,310,254 probably benign Het
4933411K16Rik T C 19: 42,053,050 Y207H probably damaging Het
Abcc1 T A 16: 14,448,434 L832Q probably damaging Het
Acan T A 7: 79,100,804 H1774Q probably benign Het
Adss T C 1: 177,772,194 T275A probably benign Het
Ano5 G A 7: 51,583,775 R595H probably damaging Het
Araf G T X: 20,859,704 R522L probably damaging Het
Arhgef28 C T 13: 97,965,546 V807I possibly damaging Het
Bin1 T C 18: 32,412,704 I103T probably damaging Het
C4b C T 17: 34,740,021 R478Q probably benign Het
Cacna1b G A 2: 24,678,035 P1015S probably benign Het
Capn1 A G 19: 6,007,498 probably null Het
Cep290 A G 10: 100,538,966 Q1358R probably damaging Het
Cfap126 T C 1: 171,125,817 probably benign Het
Chn1 T C 2: 73,679,607 probably benign Het
Cldn8 T C 16: 88,562,401 E212G probably benign Het
Cpb1 T C 3: 20,263,532 N249S probably damaging Het
Cxcr6 A T 9: 123,810,347 I138F probably benign Het
Dab2ip G A 2: 35,718,791 R579H probably damaging Het
Dcaf8 T C 1: 172,193,855 M538T probably benign Het
Dhrs4 T G 14: 55,487,650 L201V probably damaging Het
Dnah12 C T 14: 26,710,248 A407V probably benign Het
Elavl3 T A 9: 22,026,165 probably benign Het
Elp4 T C 2: 105,832,161 H88R probably benign Het
Ercc3 T C 18: 32,261,297 probably benign Het
Eri1 A G 8: 35,469,181 S329P possibly damaging Het
Erich2 A T 2: 70,512,773 probably benign Het
Esyt1 A G 10: 128,512,428 S864P possibly damaging Het
Fam170b A G 14: 32,835,631 E141G probably damaging Het
Fat1 A G 8: 45,033,390 Y3304C probably damaging Het
Fbn1 T C 2: 125,309,495 T2531A probably benign Het
Fgfr3 T C 5: 33,729,750 V166A probably damaging Het
Glt8d2 T C 10: 82,659,538 D194G probably damaging Het
Gpr89 A G 3: 96,905,210 I5T probably benign Het
Gpx6 A T 13: 21,318,920 H168L probably benign Het
Gusb T C 5: 129,998,544 T307A probably benign Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Ifngr1 A G 10: 19,601,445 D118G probably benign Het
Ipcef1 A T 10: 6,935,173 probably null Het
Kbtbd3 A T 9: 4,330,276 T217S probably benign Het
Kmt5a GAA GA 5: 124,459,885 probably null Het
Lrp1 T C 10: 127,539,011 D4526G probably damaging Het
Lrp1b A T 2: 42,323,662 V46D probably damaging Het
Lsm8 T A 6: 18,849,659 M22K probably benign Het
Map1lc3b C T 8: 121,596,600 R70C possibly damaging Het
Meiob T A 17: 24,813,052 S14T possibly damaging Het
Mkx G T 18: 6,992,330 Y183* probably null Het
Mrs2 T C 13: 25,005,034 Y99C probably benign Het
Mycbpap T C 11: 94,505,561 K151R probably benign Het
Neb T G 2: 52,328,734 Q88P probably damaging Het
Noc4l T A 5: 110,650,078 H319L probably damaging Het
Nt5c2 G A 19: 46,904,978 T122I probably damaging Het
Nuggc A T 14: 65,624,133 N476I probably damaging Het
Obscn T A 11: 59,031,036 H5978L probably benign Het
Olfr1080 A T 2: 86,553,752 V124E probably damaging Het
Olfr1143 T G 2: 87,802,868 S160A probably benign Het
Olfr1249 A G 2: 89,630,014 S295P possibly damaging Het
Olfr168 T A 16: 19,530,383 D179V possibly damaging Het
Olfr399 A G 11: 74,053,824 *312Q probably null Het
Olfr8 T A 10: 78,955,848 S214R probably benign Het
Pdzrn3 A T 6: 101,150,969 V912E probably benign Het
Phactr1 T A 13: 43,094,990 Y387N probably damaging Het
Picalm T A 7: 90,130,651 C27S probably benign Het
Pkd1l1 T A 11: 8,941,077 I314F possibly damaging Het
Pold2 T C 11: 5,874,175 E210G possibly damaging Het
Ptprz1 C T 6: 23,049,524 probably benign Het
Rac1 G T 5: 143,507,338 A165E probably damaging Het
Rpap3 G T 15: 97,686,483 T360K possibly damaging Het
Scn9a G A 2: 66,526,888 T1012I probably benign Het
Sdad1 A G 5: 92,309,823 I20T possibly damaging Het
Setbp1 T G 18: 78,859,912 K180T probably damaging Het
Sgpl1 T C 10: 61,102,589 N475S probably damaging Het
Shroom3 T C 5: 92,942,834 S1148P possibly damaging Het
Sin3a T A 9: 57,119,158 H1119Q possibly damaging Het
Slc26a7 T A 4: 14,506,489 Y620F probably benign Het
Slc4a1 T C 11: 102,361,171 I36V probably benign Het
Smarca2 C G 19: 26,631,101 P263A possibly damaging Het
Sp100 T C 1: 85,663,521 probably benign Het
Spag6l A G 16: 16,780,614 probably benign Het
Sptbn1 T C 11: 30,121,498 N1491S probably damaging Het
Tbl1xr1 T G 3: 22,190,951 V155G possibly damaging Het
Tmc1 A G 19: 20,868,355 I168T probably damaging Het
Tmem87b G A 2: 128,826,393 probably null Het
Tnfrsf9 T A 4: 150,933,104 probably null Het
Tnni3k T C 3: 154,939,658 D530G probably damaging Het
Vmn1r209 G A 13: 22,805,764 S252F probably damaging Het
Zbtb3 A T 19: 8,803,350 N109I probably damaging Het
Zdhhc17 T G 10: 110,946,210 H541P probably damaging Het
Zfp84 A G 7: 29,776,614 I244V possibly damaging Het
Zyx A G 6: 42,356,312 Y393C probably damaging Het
Other mutations in Oc90
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Oc90 APN 15 65889591 missense probably benign 0.00
IGL01746:Oc90 APN 15 65889401 splice site probably benign
IGL02101:Oc90 APN 15 65897789 missense probably damaging 1.00
IGL02175:Oc90 APN 15 65883825 missense possibly damaging 0.96
IGL02691:Oc90 APN 15 65882561 missense probably damaging 1.00
IGL02947:Oc90 APN 15 65888134 missense probably benign 0.16
R0010:Oc90 UTSW 15 65876548 missense probably damaging 1.00
R0325:Oc90 UTSW 15 65897665 critical splice donor site probably null
R1466:Oc90 UTSW 15 65897720 missense probably damaging 1.00
R1466:Oc90 UTSW 15 65897720 missense probably damaging 1.00
R1584:Oc90 UTSW 15 65897720 missense probably damaging 1.00
R1837:Oc90 UTSW 15 65889680 missense probably damaging 1.00
R3552:Oc90 UTSW 15 65878801 missense possibly damaging 0.81
R4018:Oc90 UTSW 15 65887608 missense probably benign 0.00
R4515:Oc90 UTSW 15 65892393 missense probably damaging 0.96
R4700:Oc90 UTSW 15 65881505 missense possibly damaging 0.91
R4828:Oc90 UTSW 15 65881559 missense probably damaging 1.00
R5135:Oc90 UTSW 15 65883830 missense probably benign 0.00
R5320:Oc90 UTSW 15 65882608 missense probably benign 0.06
R5727:Oc90 UTSW 15 65881539 missense possibly damaging 0.61
R5837:Oc90 UTSW 15 65876446 missense probably benign 0.03
R6086:Oc90 UTSW 15 65889711 missense probably damaging 1.00
R6807:Oc90 UTSW 15 65889614 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACGTAGCATCTTATTTCCCACC -3'
(R):5'- AGGGCTACTTCCTAGCAGAAGGAAC -3'

Sequencing Primer
(F):5'- TATTTCCCACCGAGGGGTC -3'
(R):5'- CCTAGCAGAAGGAACAGACTAGAC -3'
Posted On2014-04-13