Incidental Mutation 'R1497:Gtf3c3'
ID168925
Institutional Source Beutler Lab
Gene Symbol Gtf3c3
Ensembl Gene ENSMUSG00000041303
Gene Namegeneral transcription factor IIIC, polypeptide 3
Synonyms
MMRRC Submission 039548-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R1497 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location54396004-54438971 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54437939 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 36 (V36A)
Ref Sequence ENSEMBL: ENSMUSP00000039420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041638]
Predicted Effect probably benign
Transcript: ENSMUST00000041638
AA Change: V36A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039420
Gene: ENSMUSG00000041303
AA Change: V36A

DomainStartEndE-ValueType
low complexity region 18 34 N/A INTRINSIC
low complexity region 92 108 N/A INTRINSIC
TPR 145 178 9.24e1 SMART
TPR 179 212 2.36e1 SMART
TPR 213 246 4.58e-4 SMART
TPR 247 280 6.4e1 SMART
Blast:TPR 286 319 6e-9 BLAST
low complexity region 353 365 N/A INTRINSIC
TPR 452 485 1.87e1 SMART
low complexity region 549 560 N/A INTRINSIC
TPR 807 840 3.27e0 SMART
Meta Mutation Damage Score 0.1204 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the TFIIIC2 complex, which binds to the promoters of small nuclear and cytoplasmic RNA genes in order to recruit RNA polymerase III. The TFIIIC2 complex is composed of six subunits. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G T 11: 109,973,821 probably benign Het
Abhd17a A G 10: 80,584,330 probably benign Het
Acacb G A 5: 114,196,807 E646K probably damaging Het
Afap1l2 T C 19: 56,928,311 M262V probably benign Het
Anapc7 T A 5: 122,435,515 probably benign Het
Car5b T A X: 163,988,404 K188N probably benign Het
Caskin1 C T 17: 24,504,541 R768* probably null Het
Casp8ap2 T C 4: 32,639,938 S331P probably benign Het
Ccdc68 C T 18: 69,960,514 probably benign Het
Cd44 A T 2: 102,842,955 probably null Het
Celsr3 A G 9: 108,848,865 S3090G probably benign Het
Clasp1 A T 1: 118,552,058 M1023L probably benign Het
Clec16a T C 16: 10,635,259 F608S probably damaging Het
Col7a1 A C 9: 108,978,825 E2531A unknown Het
Ctc1 T A 11: 69,022,561 C128S probably benign Het
Cyp2d41-ps T C 15: 82,782,022 noncoding transcript Het
Cyp2j6 T A 4: 96,531,661 I278F probably damaging Het
Dhtkd1 A T 2: 5,904,113 S723R probably damaging Het
Dhx8 A G 11: 101,735,387 probably benign Het
Dnah17 A T 11: 118,114,233 L775Q probably damaging Het
Dnah8 C A 17: 30,752,075 T2701K probably damaging Het
Eml3 T A 19: 8,936,369 S424R probably damaging Het
Epm2aip1 A G 9: 111,272,247 E96G possibly damaging Het
Ezr T C 17: 6,742,708 H314R probably benign Het
Fam193b G T 13: 55,554,434 H43Q probably damaging Het
Fam208b T C 13: 3,570,409 E2164G probably damaging Het
Fam217a T A 13: 34,911,212 N340I probably damaging Het
Fcrl1 A T 3: 87,384,802 Q89H probably damaging Het
Flg2 A T 3: 93,219,769 H1996L unknown Het
Gabpb1 C T 2: 126,639,249 V327M possibly damaging Het
Hspg2 A G 4: 137,548,096 N2739S probably damaging Het
Hyal1 A G 9: 107,577,995 probably null Het
Ipo13 T C 4: 117,904,659 D448G probably benign Het
Kcnq5 T C 1: 21,402,386 D860G possibly damaging Het
Kif13b A G 14: 64,736,266 N355S probably damaging Het
Kmt2c T A 5: 25,314,515 H2199L possibly damaging Het
Magi1 A G 6: 93,747,329 F235S probably damaging Het
Maml1 A C 11: 50,265,707 M547R possibly damaging Het
Mapk7 T C 11: 61,493,863 K6E possibly damaging Het
Mbd5 T A 2: 49,257,381 N534K possibly damaging Het
Mcat G A 15: 83,549,252 Q34* probably null Het
Mcu T A 10: 59,448,848 D180V probably damaging Het
Mettl21c G T 1: 44,009,791 P199T probably benign Het
Mndal A T 1: 173,872,875 S177T probably benign Het
Mpeg1 G T 19: 12,461,247 C23F probably benign Het
Mup15 T A 4: 61,438,234 Y98F probably benign Het
Myh8 T C 11: 67,289,812 S625P probably benign Het
Nipsnap2 T C 5: 129,753,218 probably benign Het
Nlrp4e T C 7: 23,320,372 S95P probably benign Het
Olfr1196 T C 2: 88,700,762 D189G probably damaging Het
Olfr378 T A 11: 73,425,827 D52V possibly damaging Het
Otop2 A G 11: 115,329,849 probably null Het
Pcnx4 G C 12: 72,574,400 G998A probably benign Het
Pnkd C A 1: 74,351,522 probably null Het
Ppp4r4 T A 12: 103,606,945 V701E probably benign Het
Ryr2 A G 13: 11,601,841 I3897T probably damaging Het
Scn1a T C 2: 66,332,287 E205G probably damaging Het
Sdk2 G A 11: 113,893,575 probably benign Het
Serpinb5 A T 1: 106,876,052 Q156L probably benign Het
Setdb1 A T 3: 95,327,467 V975D probably benign Het
Shc1 A G 3: 89,428,445 *470W probably null Het
Sik3 T A 9: 46,202,022 V587E probably damaging Het
Sik3 C A 9: 46,221,089 H1276Q probably benign Het
Spata7 T C 12: 98,668,861 I384T probably damaging Het
Tanc2 T A 11: 105,922,137 V1469D probably benign Het
Tdrd5 A T 1: 156,255,802 N888K probably benign Het
Tex22 T C 12: 113,075,380 S34P probably benign Het
Tmed6 T C 8: 107,064,122 T98A probably benign Het
Trim66 G A 7: 109,484,619 P141L probably benign Het
Trpa1 T C 1: 14,885,812 I778V probably benign Het
Urb2 T A 8: 124,028,077 H174Q probably damaging Het
Usb1 T C 8: 95,338,697 V59A probably benign Het
Vmn1r11 T A 6: 57,137,409 N19K probably damaging Het
Vmn1r185 A T 7: 26,611,794 F95L probably benign Het
Vmn1r206 C T 13: 22,620,990 V16M probably benign Het
Vmn2r92 T C 17: 18,167,363 V210A probably benign Het
Wdr17 A T 8: 54,672,501 I448K possibly damaging Het
Zfp768 T A 7: 127,343,561 Q465L probably damaging Het
Zfp804b T A 5: 6,771,105 N617Y probably damaging Het
Other mutations in Gtf3c3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Gtf3c3 APN 1 54415955 missense probably damaging 0.99
IGL00435:Gtf3c3 APN 1 54427535 missense possibly damaging 0.73
IGL01128:Gtf3c3 APN 1 54428876 missense possibly damaging 0.91
R0243:Gtf3c3 UTSW 1 54403536 missense possibly damaging 0.60
R0271:Gtf3c3 UTSW 1 54428812 missense possibly damaging 0.96
R0571:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R0965:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R0968:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1069:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1070:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1111:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1112:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1113:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1114:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1115:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1117:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1118:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1119:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1228:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1230:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1231:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1313:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1313:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1382:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1394:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1395:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1397:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1414:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1430:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1432:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1473:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1556:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1563:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1638:Gtf3c3 UTSW 1 54405119 missense probably damaging 1.00
R1695:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1716:Gtf3c3 UTSW 1 54399260 missense probably damaging 1.00
R1745:Gtf3c3 UTSW 1 54434212 missense probably damaging 1.00
R1767:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1799:Gtf3c3 UTSW 1 54420424 missense possibly damaging 0.82
R1861:Gtf3c3 UTSW 1 54438838 missense possibly damaging 0.87
R1940:Gtf3c3 UTSW 1 54428958 splice site probably benign
R3804:Gtf3c3 UTSW 1 54424007 critical splice donor site probably null
R4496:Gtf3c3 UTSW 1 54424132 missense probably benign 0.03
R4621:Gtf3c3 UTSW 1 54419416 missense probably damaging 1.00
R5131:Gtf3c3 UTSW 1 54419498 synonymous probably null
R5320:Gtf3c3 UTSW 1 54405873 missense probably damaging 1.00
R5605:Gtf3c3 UTSW 1 54415926 missense probably benign 0.06
R5854:Gtf3c3 UTSW 1 54419437 missense probably benign 0.01
R6050:Gtf3c3 UTSW 1 54406070 missense probably benign 0.00
R6441:Gtf3c3 UTSW 1 54406038 missense probably benign 0.03
R6892:Gtf3c3 UTSW 1 54415941 missense probably benign 0.00
R7114:Gtf3c3 UTSW 1 54423507 missense probably benign
R7299:Gtf3c3 UTSW 1 54417708 missense probably benign 0.01
R7441:Gtf3c3 UTSW 1 54420448 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAATACTGagccaggcagtggtg -3'
(R):5'- TGTTTGAAGGCCAAGGGACCAAC -3'

Sequencing Primer
(F):5'- acacacctttaatcccagcac -3'
(R):5'- GGGACCAACATAAAGATCTCTTG -3'
Posted On2014-04-13