Incidental Mutation 'R1497:Serpinb5'
ID168928
Institutional Source Beutler Lab
Gene Symbol Serpinb5
Ensembl Gene ENSMUSG00000067006
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 5
Synonymsovalbumin, 1110036M19Rik, Maspin, Spi7
MMRRC Submission 039548-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.803) question?
Stock #R1497 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location106861173-106883348 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106876052 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 156 (Q156L)
Ref Sequence ENSEMBL: ENSMUSP00000108350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086701] [ENSMUST00000112729] [ENSMUST00000112730] [ENSMUST00000188745]
Predicted Effect probably benign
Transcript: ENSMUST00000086701
AA Change: Q156L

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000083908
Gene: ENSMUSG00000067006
AA Change: Q156L

DomainStartEndE-ValueType
SERPIN 13 375 9.76e-160 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112729
AA Change: Q156L

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000108349
Gene: ENSMUSG00000067006
AA Change: Q156L

DomainStartEndE-ValueType
SERPIN 13 375 9.76e-160 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112730
AA Change: Q156L

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000108350
Gene: ENSMUSG00000067006
AA Change: Q156L

DomainStartEndE-ValueType
SERPIN 13 375 9.76e-160 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188745
SMART Domains Protein: ENSMUSP00000140264
Gene: ENSMUSG00000067006

DomainStartEndE-ValueType
Pfam:Serpin 1 74 1.6e-15 PFAM
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 99% (79/80)
MGI Phenotype PHENOTYPE: Mice homozygous for one null allele displayed peri-implantation lethality with impaired endoderm development and attenuated inner cell mass growth. Mice homozygous for another null allele were viable and fertile with no gross abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G T 11: 109,973,821 probably benign Het
Abhd17a A G 10: 80,584,330 probably benign Het
Acacb G A 5: 114,196,807 E646K probably damaging Het
Afap1l2 T C 19: 56,928,311 M262V probably benign Het
Anapc7 T A 5: 122,435,515 probably benign Het
Car5b T A X: 163,988,404 K188N probably benign Het
Caskin1 C T 17: 24,504,541 R768* probably null Het
Casp8ap2 T C 4: 32,639,938 S331P probably benign Het
Ccdc68 C T 18: 69,960,514 probably benign Het
Cd44 A T 2: 102,842,955 probably null Het
Celsr3 A G 9: 108,848,865 S3090G probably benign Het
Clasp1 A T 1: 118,552,058 M1023L probably benign Het
Clec16a T C 16: 10,635,259 F608S probably damaging Het
Col7a1 A C 9: 108,978,825 E2531A unknown Het
Ctc1 T A 11: 69,022,561 C128S probably benign Het
Cyp2d41-ps T C 15: 82,782,022 noncoding transcript Het
Cyp2j6 T A 4: 96,531,661 I278F probably damaging Het
Dhtkd1 A T 2: 5,904,113 S723R probably damaging Het
Dhx8 A G 11: 101,735,387 probably benign Het
Dnah17 A T 11: 118,114,233 L775Q probably damaging Het
Dnah8 C A 17: 30,752,075 T2701K probably damaging Het
Eml3 T A 19: 8,936,369 S424R probably damaging Het
Epm2aip1 A G 9: 111,272,247 E96G possibly damaging Het
Ezr T C 17: 6,742,708 H314R probably benign Het
Fam193b G T 13: 55,554,434 H43Q probably damaging Het
Fam208b T C 13: 3,570,409 E2164G probably damaging Het
Fam217a T A 13: 34,911,212 N340I probably damaging Het
Fcrl1 A T 3: 87,384,802 Q89H probably damaging Het
Flg2 A T 3: 93,219,769 H1996L unknown Het
Gabpb1 C T 2: 126,639,249 V327M possibly damaging Het
Gtf3c3 A G 1: 54,437,939 V36A probably benign Het
Hspg2 A G 4: 137,548,096 N2739S probably damaging Het
Hyal1 A G 9: 107,577,995 probably null Het
Ipo13 T C 4: 117,904,659 D448G probably benign Het
Kcnq5 T C 1: 21,402,386 D860G possibly damaging Het
Kif13b A G 14: 64,736,266 N355S probably damaging Het
Kmt2c T A 5: 25,314,515 H2199L possibly damaging Het
Magi1 A G 6: 93,747,329 F235S probably damaging Het
Maml1 A C 11: 50,265,707 M547R possibly damaging Het
Mapk7 T C 11: 61,493,863 K6E possibly damaging Het
Mbd5 T A 2: 49,257,381 N534K possibly damaging Het
Mcat G A 15: 83,549,252 Q34* probably null Het
Mcu T A 10: 59,448,848 D180V probably damaging Het
Mettl21c G T 1: 44,009,791 P199T probably benign Het
Mndal A T 1: 173,872,875 S177T probably benign Het
Mpeg1 G T 19: 12,461,247 C23F probably benign Het
Mup15 T A 4: 61,438,234 Y98F probably benign Het
Myh8 T C 11: 67,289,812 S625P probably benign Het
Nipsnap2 T C 5: 129,753,218 probably benign Het
Nlrp4e T C 7: 23,320,372 S95P probably benign Het
Olfr1196 T C 2: 88,700,762 D189G probably damaging Het
Olfr378 T A 11: 73,425,827 D52V possibly damaging Het
Otop2 A G 11: 115,329,849 probably null Het
Pcnx4 G C 12: 72,574,400 G998A probably benign Het
Pnkd C A 1: 74,351,522 probably null Het
Ppp4r4 T A 12: 103,606,945 V701E probably benign Het
Ryr2 A G 13: 11,601,841 I3897T probably damaging Het
Scn1a T C 2: 66,332,287 E205G probably damaging Het
Sdk2 G A 11: 113,893,575 probably benign Het
Setdb1 A T 3: 95,327,467 V975D probably benign Het
Shc1 A G 3: 89,428,445 *470W probably null Het
Sik3 T A 9: 46,202,022 V587E probably damaging Het
Sik3 C A 9: 46,221,089 H1276Q probably benign Het
Spata7 T C 12: 98,668,861 I384T probably damaging Het
Tanc2 T A 11: 105,922,137 V1469D probably benign Het
Tdrd5 A T 1: 156,255,802 N888K probably benign Het
Tex22 T C 12: 113,075,380 S34P probably benign Het
Tmed6 T C 8: 107,064,122 T98A probably benign Het
Trim66 G A 7: 109,484,619 P141L probably benign Het
Trpa1 T C 1: 14,885,812 I778V probably benign Het
Urb2 T A 8: 124,028,077 H174Q probably damaging Het
Usb1 T C 8: 95,338,697 V59A probably benign Het
Vmn1r11 T A 6: 57,137,409 N19K probably damaging Het
Vmn1r185 A T 7: 26,611,794 F95L probably benign Het
Vmn1r206 C T 13: 22,620,990 V16M probably benign Het
Vmn2r92 T C 17: 18,167,363 V210A probably benign Het
Wdr17 A T 8: 54,672,501 I448K possibly damaging Het
Zfp768 T A 7: 127,343,561 Q465L probably damaging Het
Zfp804b T A 5: 6,771,105 N617Y probably damaging Het
Other mutations in Serpinb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02237:Serpinb5 APN 1 106880326 missense probably benign 0.01
R1385:Serpinb5 UTSW 1 106876123 missense probably damaging 1.00
R1480:Serpinb5 UTSW 1 106881707 missense probably benign
R1503:Serpinb5 UTSW 1 106870289 missense possibly damaging 0.76
R1933:Serpinb5 UTSW 1 106876121 missense probably damaging 0.99
R2400:Serpinb5 UTSW 1 106881952 missense probably damaging 0.98
R2567:Serpinb5 UTSW 1 106875146 missense probably benign 0.33
R2923:Serpinb5 UTSW 1 106876040 missense probably benign
R3148:Serpinb5 UTSW 1 106881825 missense probably damaging 1.00
R3820:Serpinb5 UTSW 1 106875072 nonsense probably null
R4667:Serpinb5 UTSW 1 106872295 missense probably benign 0.00
R4814:Serpinb5 UTSW 1 106872339 missense probably damaging 1.00
R4815:Serpinb5 UTSW 1 106872339 missense probably damaging 1.00
R4816:Serpinb5 UTSW 1 106872339 missense probably damaging 1.00
R4817:Serpinb5 UTSW 1 106872339 missense probably damaging 1.00
R5369:Serpinb5 UTSW 1 106881757 missense possibly damaging 0.85
R6108:Serpinb5 UTSW 1 106881728 missense probably damaging 1.00
R6222:Serpinb5 UTSW 1 106870340 missense probably benign 0.09
R6251:Serpinb5 UTSW 1 106875065 missense possibly damaging 0.96
R6349:Serpinb5 UTSW 1 106881765 missense probably benign 0.44
R6936:Serpinb5 UTSW 1 106870418 missense probably benign 0.00
R6977:Serpinb5 UTSW 1 106872347 missense probably benign 0.20
R7332:Serpinb5 UTSW 1 106872361 missense probably benign 0.00
R7369:Serpinb5 UTSW 1 106875149 missense probably benign 0.29
R7443:Serpinb5 UTSW 1 106881970 missense probably benign 0.00
R7499:Serpinb5 UTSW 1 106872389 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAACACCCCAGTCAGTTGTCTTTCC -3'
(R):5'- ACAATCCGGTGGCCTCTAGTTTGC -3'

Sequencing Primer
(F):5'- TCCTTTCCTAGAGATGTGTTTACAG -3'
(R):5'- TCTGCACAGAGATTCATTCCTG -3'
Posted On2014-04-13