Incidental Mutation 'R1497:Gabpb1'
ID168937
Institutional Source Beutler Lab
Gene Symbol Gabpb1
Ensembl Gene ENSMUSG00000027361
Gene NameGA repeat binding protein, beta 1
SynonymsGABPB1-1, E4TF1-47, GABPB1-2, E4Tf1B, BABPB2, NRF2B2, E4TF1, E4TF1-53, NRF2B1
MMRRC Submission 039548-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1497 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location126627442-126676337 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 126639249 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 327 (V327M)
Ref Sequence ENSEMBL: ENSMUSP00000106055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039978] [ENSMUST00000103226] [ENSMUST00000103227] [ENSMUST00000110424] [ENSMUST00000110425]
Predicted Effect probably benign
Transcript: ENSMUST00000039978
AA Change: V326M

PolyPhen 2 Score 0.449 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000037673
Gene: ENSMUSG00000027361
AA Change: V326M

DomainStartEndE-ValueType
Blast:ANK 5 34 1e-8 BLAST
ANK 37 66 3.36e-2 SMART
ANK 70 99 9.7e-8 SMART
ANK 103 132 1.76e-5 SMART
ANK 136 166 3.58e2 SMART
low complexity region 206 244 N/A INTRINSIC
low complexity region 249 259 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000103226
AA Change: V327M

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099516
Gene: ENSMUSG00000027361
AA Change: V327M

DomainStartEndE-ValueType
Blast:ANK 5 34 1e-8 BLAST
ANK 37 66 3.36e-2 SMART
ANK 70 99 9.7e-8 SMART
ANK 103 132 1.76e-5 SMART
ANK 136 166 3.58e2 SMART
low complexity region 206 245 N/A INTRINSIC
low complexity region 250 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103227
AA Change: V326M

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099517
Gene: ENSMUSG00000027361
AA Change: V326M

DomainStartEndE-ValueType
Blast:ANK 5 34 3e-8 BLAST
ANK 37 66 3.36e-2 SMART
ANK 70 99 9.7e-8 SMART
ANK 103 132 1.76e-5 SMART
ANK 136 166 3.58e2 SMART
low complexity region 206 244 N/A INTRINSIC
low complexity region 249 259 N/A INTRINSIC
coiled coil region 328 381 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110424
AA Change: V326M

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000106054
Gene: ENSMUSG00000027361
AA Change: V326M

DomainStartEndE-ValueType
Blast:ANK 5 34 3e-8 BLAST
ANK 37 66 3.36e-2 SMART
ANK 70 99 9.7e-8 SMART
ANK 103 132 1.76e-5 SMART
ANK 136 166 3.58e2 SMART
low complexity region 206 244 N/A INTRINSIC
low complexity region 249 259 N/A INTRINSIC
coiled coil region 328 381 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110425
AA Change: V327M

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106055
Gene: ENSMUSG00000027361
AA Change: V327M

DomainStartEndE-ValueType
Blast:ANK 5 34 3e-8 BLAST
ANK 37 66 3.36e-2 SMART
ANK 70 99 9.7e-8 SMART
ANK 103 132 1.76e-5 SMART
ANK 136 166 3.58e2 SMART
low complexity region 206 245 N/A INTRINSIC
low complexity region 250 260 N/A INTRINSIC
coiled coil region 329 382 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157575
Meta Mutation Damage Score 0.208 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the GA-binding protein transcription factor, beta subunit. This protein forms a tetrameric complex with the alpha subunit, and stimulates transcription of target genes. The encoded protein may be involved in activation of cytochrome oxidase expression and nuclear control of mitochondrial function. The crystal structure of a similar protein in mouse has been resolved as a ternary protein complex. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality by E12.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G T 11: 109,973,821 probably benign Het
Abhd17a A G 10: 80,584,330 probably benign Het
Acacb G A 5: 114,196,807 E646K probably damaging Het
Afap1l2 T C 19: 56,928,311 M262V probably benign Het
Anapc7 T A 5: 122,435,515 probably benign Het
Car5b T A X: 163,988,404 K188N probably benign Het
Caskin1 C T 17: 24,504,541 R768* probably null Het
Casp8ap2 T C 4: 32,639,938 S331P probably benign Het
Ccdc68 C T 18: 69,960,514 probably benign Het
Cd44 A T 2: 102,842,955 probably null Het
Celsr3 A G 9: 108,848,865 S3090G probably benign Het
Clasp1 A T 1: 118,552,058 M1023L probably benign Het
Clec16a T C 16: 10,635,259 F608S probably damaging Het
Col7a1 A C 9: 108,978,825 E2531A unknown Het
Ctc1 T A 11: 69,022,561 C128S probably benign Het
Cyp2d41-ps T C 15: 82,782,022 noncoding transcript Het
Cyp2j6 T A 4: 96,531,661 I278F probably damaging Het
Dhtkd1 A T 2: 5,904,113 S723R probably damaging Het
Dhx8 A G 11: 101,735,387 probably benign Het
Dnah17 A T 11: 118,114,233 L775Q probably damaging Het
Dnah8 C A 17: 30,752,075 T2701K probably damaging Het
Eml3 T A 19: 8,936,369 S424R probably damaging Het
Epm2aip1 A G 9: 111,272,247 E96G possibly damaging Het
Ezr T C 17: 6,742,708 H314R probably benign Het
Fam193b G T 13: 55,554,434 H43Q probably damaging Het
Fam208b T C 13: 3,570,409 E2164G probably damaging Het
Fam217a T A 13: 34,911,212 N340I probably damaging Het
Fcrl1 A T 3: 87,384,802 Q89H probably damaging Het
Flg2 A T 3: 93,219,769 H1996L unknown Het
Gtf3c3 A G 1: 54,437,939 V36A probably benign Het
Hspg2 A G 4: 137,548,096 N2739S probably damaging Het
Hyal1 A G 9: 107,577,995 probably null Het
Ipo13 T C 4: 117,904,659 D448G probably benign Het
Kcnq5 T C 1: 21,402,386 D860G possibly damaging Het
Kif13b A G 14: 64,736,266 N355S probably damaging Het
Kmt2c T A 5: 25,314,515 H2199L possibly damaging Het
Magi1 A G 6: 93,747,329 F235S probably damaging Het
Maml1 A C 11: 50,265,707 M547R possibly damaging Het
Mapk7 T C 11: 61,493,863 K6E possibly damaging Het
Mbd5 T A 2: 49,257,381 N534K possibly damaging Het
Mcat G A 15: 83,549,252 Q34* probably null Het
Mcu T A 10: 59,448,848 D180V probably damaging Het
Mettl21c G T 1: 44,009,791 P199T probably benign Het
Mndal A T 1: 173,872,875 S177T probably benign Het
Mpeg1 G T 19: 12,461,247 C23F probably benign Het
Mup15 T A 4: 61,438,234 Y98F probably benign Het
Myh8 T C 11: 67,289,812 S625P probably benign Het
Nipsnap2 T C 5: 129,753,218 probably benign Het
Nlrp4e T C 7: 23,320,372 S95P probably benign Het
Olfr1196 T C 2: 88,700,762 D189G probably damaging Het
Olfr378 T A 11: 73,425,827 D52V possibly damaging Het
Otop2 A G 11: 115,329,849 probably null Het
Pcnx4 G C 12: 72,574,400 G998A probably benign Het
Pnkd C A 1: 74,351,522 probably null Het
Ppp4r4 T A 12: 103,606,945 V701E probably benign Het
Ryr2 A G 13: 11,601,841 I3897T probably damaging Het
Scn1a T C 2: 66,332,287 E205G probably damaging Het
Sdk2 G A 11: 113,893,575 probably benign Het
Serpinb5 A T 1: 106,876,052 Q156L probably benign Het
Setdb1 A T 3: 95,327,467 V975D probably benign Het
Shc1 A G 3: 89,428,445 *470W probably null Het
Sik3 T A 9: 46,202,022 V587E probably damaging Het
Sik3 C A 9: 46,221,089 H1276Q probably benign Het
Spata7 T C 12: 98,668,861 I384T probably damaging Het
Tanc2 T A 11: 105,922,137 V1469D probably benign Het
Tdrd5 A T 1: 156,255,802 N888K probably benign Het
Tex22 T C 12: 113,075,380 S34P probably benign Het
Tmed6 T C 8: 107,064,122 T98A probably benign Het
Trim66 G A 7: 109,484,619 P141L probably benign Het
Trpa1 T C 1: 14,885,812 I778V probably benign Het
Urb2 T A 8: 124,028,077 H174Q probably damaging Het
Usb1 T C 8: 95,338,697 V59A probably benign Het
Vmn1r11 T A 6: 57,137,409 N19K probably damaging Het
Vmn1r185 A T 7: 26,611,794 F95L probably benign Het
Vmn1r206 C T 13: 22,620,990 V16M probably benign Het
Vmn2r92 T C 17: 18,167,363 V210A probably benign Het
Wdr17 A T 8: 54,672,501 I448K possibly damaging Het
Zfp768 T A 7: 127,343,561 Q465L probably damaging Het
Zfp804b T A 5: 6,771,105 N617Y probably damaging Het
Other mutations in Gabpb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Gabpb1 APN 2 126653600 missense possibly damaging 0.83
IGL02085:Gabpb1 APN 2 126639271 nonsense probably null
IGL02190:Gabpb1 APN 2 126653549 unclassified probably benign
R0034:Gabpb1 UTSW 2 126658534 missense possibly damaging 0.94
R0114:Gabpb1 UTSW 2 126653574 missense probably damaging 0.98
R0800:Gabpb1 UTSW 2 126630328 missense probably damaging 0.99
R0925:Gabpb1 UTSW 2 126652265 missense probably damaging 1.00
R1467:Gabpb1 UTSW 2 126652327 missense probably damaging 0.99
R1467:Gabpb1 UTSW 2 126652327 missense probably damaging 0.99
R1569:Gabpb1 UTSW 2 126652251 missense probably benign 0.09
R2860:Gabpb1 UTSW 2 126653574 missense probably damaging 0.98
R2861:Gabpb1 UTSW 2 126653574 missense probably damaging 0.98
R5284:Gabpb1 UTSW 2 126652357 missense possibly damaging 0.93
R5984:Gabpb1 UTSW 2 126646653 missense probably damaging 0.99
R7200:Gabpb1 UTSW 2 126639302 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CCAAAGACAGTCCAAGTGTTACCAGG -3'
(R):5'- GCACTACAGTAAGTGGGCTTCAGTGAG -3'

Sequencing Primer
(F):5'- gagggcttgccatatgTTTAAGG -3'
(R):5'- CCTCTTCATAGAGGAGCAGTG -3'
Posted On2014-04-13