Incidental Mutation 'R1497:Casp8ap2'
ID168942
Institutional Source Beutler Lab
Gene Symbol Casp8ap2
Ensembl Gene ENSMUSG00000028282
Gene Namecaspase 8 associated protein 2
SynonymsFLASH, D4Ertd659e
MMRRC Submission 039548-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1497 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location32615451-32653265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32639938 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 331 (S331P)
Ref Sequence ENSEMBL: ENSMUSP00000136016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029950] [ENSMUST00000108178] [ENSMUST00000178925]
Predicted Effect probably benign
Transcript: ENSMUST00000029950
AA Change: S331P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000029950
Gene: ENSMUSG00000028282
AA Change: S331P

DomainStartEndE-ValueType
coiled coil region 68 142 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 458 477 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1250 1268 N/A INTRINSIC
low complexity region 1360 1377 N/A INTRINSIC
low complexity region 1458 1470 N/A INTRINSIC
low complexity region 1477 1498 N/A INTRINSIC
low complexity region 1882 1895 N/A INTRINSIC
PDB:2LR8|A 1896 1962 1e-31 PDB
Blast:SANT 1905 1955 2e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000108178
SMART Domains Protein: ENSMUSP00000103813
Gene: ENSMUSG00000028282

DomainStartEndE-ValueType
PDB:2LR8|A 126 190 4e-26 PDB
Blast:SANT 139 183 4e-19 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127619
Predicted Effect probably benign
Transcript: ENSMUST00000178925
AA Change: S331P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000136016
Gene: ENSMUSG00000028282
AA Change: S331P

DomainStartEndE-ValueType
coiled coil region 68 142 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 458 477 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1250 1268 N/A INTRINSIC
low complexity region 1360 1377 N/A INTRINSIC
low complexity region 1458 1470 N/A INTRINSIC
low complexity region 1477 1498 N/A INTRINSIC
low complexity region 1882 1895 N/A INTRINSIC
PDB:2LR8|A 1896 1962 1e-31 PDB
Blast:SANT 1905 1955 2e-21 BLAST
Meta Mutation Damage Score 0.372 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein is highly similar to FLASH, a mouse apoptotic protein identified by its interaction with the death-effector domain (DED) of caspase 8. Studies of FLASH protein suggested that this protein may be a component of the death-inducing signaling complex that includes Fas receptor, Fas-binding adapter FADD, and caspase 8, and plays a regulatory role in Fas-mediated apoptosis. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for disruption of this gene die before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G T 11: 109,973,821 probably benign Het
Abhd17a A G 10: 80,584,330 probably benign Het
Acacb G A 5: 114,196,807 E646K probably damaging Het
Afap1l2 T C 19: 56,928,311 M262V probably benign Het
Anapc7 T A 5: 122,435,515 probably benign Het
Car5b T A X: 163,988,404 K188N probably benign Het
Caskin1 C T 17: 24,504,541 R768* probably null Het
Ccdc68 C T 18: 69,960,514 probably benign Het
Cd44 A T 2: 102,842,955 probably null Het
Celsr3 A G 9: 108,848,865 S3090G probably benign Het
Clasp1 A T 1: 118,552,058 M1023L probably benign Het
Clec16a T C 16: 10,635,259 F608S probably damaging Het
Col7a1 A C 9: 108,978,825 E2531A unknown Het
Ctc1 T A 11: 69,022,561 C128S probably benign Het
Cyp2d41-ps T C 15: 82,782,022 noncoding transcript Het
Cyp2j6 T A 4: 96,531,661 I278F probably damaging Het
Dhtkd1 A T 2: 5,904,113 S723R probably damaging Het
Dhx8 A G 11: 101,735,387 probably benign Het
Dnah17 A T 11: 118,114,233 L775Q probably damaging Het
Dnah8 C A 17: 30,752,075 T2701K probably damaging Het
Eml3 T A 19: 8,936,369 S424R probably damaging Het
Epm2aip1 A G 9: 111,272,247 E96G possibly damaging Het
Ezr T C 17: 6,742,708 H314R probably benign Het
Fam193b G T 13: 55,554,434 H43Q probably damaging Het
Fam208b T C 13: 3,570,409 E2164G probably damaging Het
Fam217a T A 13: 34,911,212 N340I probably damaging Het
Fcrl1 A T 3: 87,384,802 Q89H probably damaging Het
Flg2 A T 3: 93,219,769 H1996L unknown Het
Gabpb1 C T 2: 126,639,249 V327M possibly damaging Het
Gtf3c3 A G 1: 54,437,939 V36A probably benign Het
Hspg2 A G 4: 137,548,096 N2739S probably damaging Het
Hyal1 A G 9: 107,577,995 probably null Het
Ipo13 T C 4: 117,904,659 D448G probably benign Het
Kcnq5 T C 1: 21,402,386 D860G possibly damaging Het
Kif13b A G 14: 64,736,266 N355S probably damaging Het
Kmt2c T A 5: 25,314,515 H2199L possibly damaging Het
Magi1 A G 6: 93,747,329 F235S probably damaging Het
Maml1 A C 11: 50,265,707 M547R possibly damaging Het
Mapk7 T C 11: 61,493,863 K6E possibly damaging Het
Mbd5 T A 2: 49,257,381 N534K possibly damaging Het
Mcat G A 15: 83,549,252 Q34* probably null Het
Mcu T A 10: 59,448,848 D180V probably damaging Het
Mettl21c G T 1: 44,009,791 P199T probably benign Het
Mndal A T 1: 173,872,875 S177T probably benign Het
Mpeg1 G T 19: 12,461,247 C23F probably benign Het
Mup15 T A 4: 61,438,234 Y98F probably benign Het
Myh8 T C 11: 67,289,812 S625P probably benign Het
Nipsnap2 T C 5: 129,753,218 probably benign Het
Nlrp4e T C 7: 23,320,372 S95P probably benign Het
Olfr1196 T C 2: 88,700,762 D189G probably damaging Het
Olfr378 T A 11: 73,425,827 D52V possibly damaging Het
Otop2 A G 11: 115,329,849 probably null Het
Pcnx4 G C 12: 72,574,400 G998A probably benign Het
Pnkd C A 1: 74,351,522 probably null Het
Ppp4r4 T A 12: 103,606,945 V701E probably benign Het
Ryr2 A G 13: 11,601,841 I3897T probably damaging Het
Scn1a T C 2: 66,332,287 E205G probably damaging Het
Sdk2 G A 11: 113,893,575 probably benign Het
Serpinb5 A T 1: 106,876,052 Q156L probably benign Het
Setdb1 A T 3: 95,327,467 V975D probably benign Het
Shc1 A G 3: 89,428,445 *470W probably null Het
Sik3 T A 9: 46,202,022 V587E probably damaging Het
Sik3 C A 9: 46,221,089 H1276Q probably benign Het
Spata7 T C 12: 98,668,861 I384T probably damaging Het
Tanc2 T A 11: 105,922,137 V1469D probably benign Het
Tdrd5 A T 1: 156,255,802 N888K probably benign Het
Tex22 T C 12: 113,075,380 S34P probably benign Het
Tmed6 T C 8: 107,064,122 T98A probably benign Het
Trim66 G A 7: 109,484,619 P141L probably benign Het
Trpa1 T C 1: 14,885,812 I778V probably benign Het
Urb2 T A 8: 124,028,077 H174Q probably damaging Het
Usb1 T C 8: 95,338,697 V59A probably benign Het
Vmn1r11 T A 6: 57,137,409 N19K probably damaging Het
Vmn1r185 A T 7: 26,611,794 F95L probably benign Het
Vmn1r206 C T 13: 22,620,990 V16M probably benign Het
Vmn2r92 T C 17: 18,167,363 V210A probably benign Het
Wdr17 A T 8: 54,672,501 I448K possibly damaging Het
Zfp768 T A 7: 127,343,561 Q465L probably damaging Het
Zfp804b T A 5: 6,771,105 N617Y probably damaging Het
Other mutations in Casp8ap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00686:Casp8ap2 APN 4 32641433 missense probably damaging 1.00
IGL00714:Casp8ap2 APN 4 32649192 missense probably damaging 1.00
IGL00754:Casp8ap2 APN 4 32641036 missense probably benign 0.00
IGL00954:Casp8ap2 APN 4 32645403 missense probably damaging 1.00
IGL00970:Casp8ap2 APN 4 32646182 missense probably benign
IGL01534:Casp8ap2 APN 4 32648134 splice site probably benign
IGL01596:Casp8ap2 APN 4 32646365 missense probably damaging 1.00
IGL01686:Casp8ap2 APN 4 32641294 missense possibly damaging 0.94
IGL02002:Casp8ap2 APN 4 32639391 missense probably damaging 1.00
IGL02273:Casp8ap2 APN 4 32643974 missense probably damaging 1.00
IGL02510:Casp8ap2 APN 4 32639704 missense probably benign 0.05
IGL02600:Casp8ap2 APN 4 32630246 missense probably null 1.00
IGL02929:Casp8ap2 APN 4 32624105 utr 5 prime probably benign
F5770:Casp8ap2 UTSW 4 32639944 missense probably benign 0.00
IGL02988:Casp8ap2 UTSW 4 32644590 missense probably benign 0.14
R0023:Casp8ap2 UTSW 4 32640185 missense probably damaging 0.99
R0027:Casp8ap2 UTSW 4 32643810 missense probably benign 0.01
R0090:Casp8ap2 UTSW 4 32640327 missense probably damaging 1.00
R0117:Casp8ap2 UTSW 4 32640817 missense probably benign 0.00
R0144:Casp8ap2 UTSW 4 32643797 missense possibly damaging 0.50
R0268:Casp8ap2 UTSW 4 32644079 missense probably damaging 0.99
R0344:Casp8ap2 UTSW 4 32644079 missense probably damaging 0.99
R0555:Casp8ap2 UTSW 4 32640381 missense probably damaging 1.00
R1051:Casp8ap2 UTSW 4 32640790 missense probably benign 0.28
R1165:Casp8ap2 UTSW 4 32640563 missense probably benign 0.01
R1243:Casp8ap2 UTSW 4 32645687 missense probably benign 0.03
R1311:Casp8ap2 UTSW 4 32648111 missense probably damaging 0.98
R1337:Casp8ap2 UTSW 4 32645721 missense possibly damaging 0.64
R1471:Casp8ap2 UTSW 4 32639386 nonsense probably null
R1521:Casp8ap2 UTSW 4 32631867 missense probably damaging 1.00
R1588:Casp8ap2 UTSW 4 32640541 missense probably benign 0.00
R1625:Casp8ap2 UTSW 4 32648068 missense probably benign 0.04
R1731:Casp8ap2 UTSW 4 32641442 missense possibly damaging 0.94
R1899:Casp8ap2 UTSW 4 32643647 missense probably damaging 0.98
R2000:Casp8ap2 UTSW 4 32634874 missense probably damaging 1.00
R2021:Casp8ap2 UTSW 4 32644560 missense probably benign 0.05
R2022:Casp8ap2 UTSW 4 32644560 missense probably benign 0.05
R2023:Casp8ap2 UTSW 4 32644560 missense probably benign 0.05
R2088:Casp8ap2 UTSW 4 32631126 missense probably damaging 1.00
R2104:Casp8ap2 UTSW 4 32644727 missense probably benign 0.00
R2128:Casp8ap2 UTSW 4 32640142 missense probably benign 0.06
R2129:Casp8ap2 UTSW 4 32640142 missense probably benign 0.06
R2305:Casp8ap2 UTSW 4 32646411 missense probably damaging 1.00
R2316:Casp8ap2 UTSW 4 32643781 missense probably benign 0.31
R2919:Casp8ap2 UTSW 4 32645343 missense probably damaging 1.00
R4091:Casp8ap2 UTSW 4 32643611 missense probably damaging 1.00
R4357:Casp8ap2 UTSW 4 32646150 missense probably benign 0.00
R4807:Casp8ap2 UTSW 4 32644505 missense possibly damaging 0.89
R4828:Casp8ap2 UTSW 4 32639807 missense probably benign
R4908:Casp8ap2 UTSW 4 32639905 missense possibly damaging 0.90
R4945:Casp8ap2 UTSW 4 32631163 missense possibly damaging 0.57
R4962:Casp8ap2 UTSW 4 32640554 missense probably damaging 0.99
R6014:Casp8ap2 UTSW 4 32641400 missense probably damaging 0.97
R6092:Casp8ap2 UTSW 4 32639380 missense probably damaging 1.00
R6257:Casp8ap2 UTSW 4 32641364 missense possibly damaging 0.94
R6289:Casp8ap2 UTSW 4 32639590 missense probably damaging 1.00
R6482:Casp8ap2 UTSW 4 32634813 missense probably damaging 1.00
R6496:Casp8ap2 UTSW 4 32641553 missense probably benign 0.05
R6515:Casp8ap2 UTSW 4 32646423 missense possibly damaging 0.64
R7015:Casp8ap2 UTSW 4 32644278 missense probably damaging 1.00
R7033:Casp8ap2 UTSW 4 32639392 missense probably damaging 1.00
R7072:Casp8ap2 UTSW 4 32644766 missense probably damaging 1.00
V7580:Casp8ap2 UTSW 4 32639944 missense probably benign 0.00
X0018:Casp8ap2 UTSW 4 32643738 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGGCACTAGACATAGCCAGTGTAGC -3'
(R):5'- TGAAAGCCATGACTGTTCATCCCTC -3'

Sequencing Primer
(F):5'- AGCTGTAATGACAGTGAGCC -3'
(R):5'- GAAGCCGTAATGTTTCACGTC -3'
Posted On2014-04-13