Incidental Mutation 'R1497:Magi1'
ID168954
Institutional Source Beutler Lab
Gene Symbol Magi1
Ensembl Gene ENSMUSG00000045095
Gene Namemembrane associated guanylate kinase, WW and PDZ domain containing 1
SynonymsAIP3, Baiap1, BAP1, Gukmi1, WWP3
MMRRC Submission 039548-MU
Accession Numbers

NCBI RefSeq: NM_010367.2; NM_001083320.1 NM_001029850.3, NM_001083321.1; MGI: 1203522

Is this an essential gene? Possibly non essential (E-score: 0.322) question?
Stock #R1497 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location93675455-94283917 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93747329 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 235 (F235S)
Ref Sequence ENSEMBL: ENSMUSP00000144769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055224] [ENSMUST00000089317] [ENSMUST00000093769] [ENSMUST00000203519] [ENSMUST00000203688] [ENSMUST00000204347] [ENSMUST00000204532]
Predicted Effect probably damaging
Transcript: ENSMUST00000055224
AA Change: F450S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000062085
Gene: ENSMUSG00000045095
AA Change: F450S

DomainStartEndE-ValueType
PDZ 26 105 8.04e-5 SMART
GuKc 111 295 2.55e-49 SMART
WW 301 333 9.65e-11 SMART
WW 348 380 2.88e-9 SMART
low complexity region 390 402 N/A INTRINSIC
low complexity region 410 428 N/A INTRINSIC
PDZ 460 536 3.71e-18 SMART
PDZ 631 703 4.68e-15 SMART
low complexity region 707 714 N/A INTRINSIC
low complexity region 720 733 N/A INTRINSIC
PDZ 800 876 4.64e-19 SMART
low complexity region 920 942 N/A INTRINSIC
PDB:1UEW|A 945 977 2e-6 PDB
PDZ 1043 1117 1.26e-20 SMART
low complexity region 1152 1164 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000089317
AA Change: F462S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000086730
Gene: ENSMUSG00000045095
AA Change: F462S

DomainStartEndE-ValueType
PDZ 26 105 4e-7 SMART
GuKc 111 295 1.3e-51 SMART
WW 301 333 5.8e-13 SMART
WW 360 392 1.7e-11 SMART
low complexity region 402 414 N/A INTRINSIC
low complexity region 422 440 N/A INTRINSIC
PDZ 472 548 1.9e-20 SMART
PDZ 643 715 2.3e-17 SMART
low complexity region 733 746 N/A INTRINSIC
PDZ 841 917 2.4e-21 SMART
low complexity region 961 983 N/A INTRINSIC
PDZ 999 1074 6.1e-25 SMART
PDZ 1140 1214 6.1e-23 SMART
low complexity region 1347 1357 N/A INTRINSIC
low complexity region 1366 1423 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093769
AA Change: F235S

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000091283
Gene: ENSMUSG00000045095
AA Change: F235S

DomainStartEndE-ValueType
low complexity region 10 15 N/A INTRINSIC
WW 74 106 9.65e-11 SMART
WW 133 165 2.88e-9 SMART
low complexity region 175 187 N/A INTRINSIC
low complexity region 195 213 N/A INTRINSIC
PDZ 245 321 3.71e-18 SMART
PDZ 416 488 4.68e-15 SMART
low complexity region 492 499 N/A INTRINSIC
low complexity region 505 518 N/A INTRINSIC
PDZ 613 689 4.64e-19 SMART
low complexity region 733 755 N/A INTRINSIC
PDZ 771 858 2.3e-23 SMART
PDZ 924 998 1.26e-20 SMART
low complexity region 1131 1141 N/A INTRINSIC
low complexity region 1150 1207 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203519
AA Change: F462S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000145244
Gene: ENSMUSG00000045095
AA Change: F462S

DomainStartEndE-ValueType
PDZ 26 105 8.04e-5 SMART
GuKc 111 295 2.55e-49 SMART
WW 301 333 9.65e-11 SMART
WW 360 392 2.88e-9 SMART
low complexity region 402 414 N/A INTRINSIC
low complexity region 422 440 N/A INTRINSIC
PDZ 472 548 3.71e-18 SMART
PDZ 643 715 4.68e-15 SMART
low complexity region 719 726 N/A INTRINSIC
low complexity region 732 745 N/A INTRINSIC
PDZ 812 888 4.64e-19 SMART
low complexity region 932 954 N/A INTRINSIC
PDB:1UEW|A 957 989 2e-6 PDB
PDZ 1055 1115 1.13e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203688
AA Change: F235S

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000145515
Gene: ENSMUSG00000045095
AA Change: F235S

DomainStartEndE-ValueType
Pfam:MAGI_u1 1 34 2.9e-17 PFAM
WW 74 106 9.65e-11 SMART
WW 133 165 2.88e-9 SMART
low complexity region 175 187 N/A INTRINSIC
low complexity region 195 213 N/A INTRINSIC
PDZ 245 321 3.71e-18 SMART
PDZ 416 488 4.68e-15 SMART
low complexity region 506 519 N/A INTRINSIC
PDZ 614 690 4.64e-19 SMART
low complexity region 734 756 N/A INTRINSIC
PDZ 772 858 1.74e-23 SMART
PDZ 924 998 1.26e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204347
AA Change: F462S

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144881
Gene: ENSMUSG00000045095
AA Change: F462S

DomainStartEndE-ValueType
PDZ 26 105 4e-7 SMART
GuKc 111 295 1.3e-51 SMART
WW 301 333 5.8e-13 SMART
WW 360 392 1.7e-11 SMART
low complexity region 402 414 N/A INTRINSIC
low complexity region 422 440 N/A INTRINSIC
PDZ 472 548 1.9e-20 SMART
PDZ 643 715 2.3e-17 SMART
low complexity region 733 746 N/A INTRINSIC
PDZ 841 917 2.4e-21 SMART
low complexity region 961 983 N/A INTRINSIC
PDZ 999 1086 1.1e-25 SMART
PDZ 1152 1226 6.1e-23 SMART
low complexity region 1261 1273 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000204532
AA Change: F235S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144769
Gene: ENSMUSG00000045095
AA Change: F235S

DomainStartEndE-ValueType
Pfam:MAGI_u1 1 34 1.8e-14 PFAM
WW 74 106 5.8e-13 SMART
WW 133 165 1.7e-11 SMART
low complexity region 175 187 N/A INTRINSIC
low complexity region 195 213 N/A INTRINSIC
PDZ 245 321 1.9e-20 SMART
PDZ 416 488 7.3e-17 SMART
Meta Mutation Damage Score 0.212 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the membrane-associated guanylate kinase homologue (MAGUK) family. MAGUK proteins participate in the assembly of multiprotein complexes on the inner surface of the plasma membrane at regions of cell-cell contact. The product of this gene may play a role as scaffolding protein at cell-cell junctions. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(165) : Targeted(2) Gene trapped(163)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G T 11: 109,973,821 probably benign Het
Abhd17a A G 10: 80,584,330 probably benign Het
Acacb G A 5: 114,196,807 E646K probably damaging Het
Afap1l2 T C 19: 56,928,311 M262V probably benign Het
Anapc7 T A 5: 122,435,515 probably benign Het
Car5b T A X: 163,988,404 K188N probably benign Het
Caskin1 C T 17: 24,504,541 R768* probably null Het
Casp8ap2 T C 4: 32,639,938 S331P probably benign Het
Ccdc68 C T 18: 69,960,514 probably benign Het
Cd44 A T 2: 102,842,955 probably null Het
Celsr3 A G 9: 108,848,865 S3090G probably benign Het
Clasp1 A T 1: 118,552,058 M1023L probably benign Het
Clec16a T C 16: 10,635,259 F608S probably damaging Het
Col7a1 A C 9: 108,978,825 E2531A unknown Het
Ctc1 T A 11: 69,022,561 C128S probably benign Het
Cyp2d41-ps T C 15: 82,782,022 noncoding transcript Het
Cyp2j6 T A 4: 96,531,661 I278F probably damaging Het
Dhtkd1 A T 2: 5,904,113 S723R probably damaging Het
Dhx8 A G 11: 101,735,387 probably benign Het
Dnah17 A T 11: 118,114,233 L775Q probably damaging Het
Dnah8 C A 17: 30,752,075 T2701K probably damaging Het
Eml3 T A 19: 8,936,369 S424R probably damaging Het
Epm2aip1 A G 9: 111,272,247 E96G possibly damaging Het
Ezr T C 17: 6,742,708 H314R probably benign Het
Fam193b G T 13: 55,554,434 H43Q probably damaging Het
Fam208b T C 13: 3,570,409 E2164G probably damaging Het
Fam217a T A 13: 34,911,212 N340I probably damaging Het
Fcrl1 A T 3: 87,384,802 Q89H probably damaging Het
Flg2 A T 3: 93,219,769 H1996L unknown Het
Gabpb1 C T 2: 126,639,249 V327M possibly damaging Het
Gtf3c3 A G 1: 54,437,939 V36A probably benign Het
Hspg2 A G 4: 137,548,096 N2739S probably damaging Het
Hyal1 A G 9: 107,577,995 probably null Het
Ipo13 T C 4: 117,904,659 D448G probably benign Het
Kcnq5 T C 1: 21,402,386 D860G possibly damaging Het
Kif13b A G 14: 64,736,266 N355S probably damaging Het
Kmt2c T A 5: 25,314,515 H2199L possibly damaging Het
Maml1 A C 11: 50,265,707 M547R possibly damaging Het
Mapk7 T C 11: 61,493,863 K6E possibly damaging Het
Mbd5 T A 2: 49,257,381 N534K possibly damaging Het
Mcat G A 15: 83,549,252 Q34* probably null Het
Mcu T A 10: 59,448,848 D180V probably damaging Het
Mettl21c G T 1: 44,009,791 P199T probably benign Het
Mndal A T 1: 173,872,875 S177T probably benign Het
Mpeg1 G T 19: 12,461,247 C23F probably benign Het
Mup15 T A 4: 61,438,234 Y98F probably benign Het
Myh8 T C 11: 67,289,812 S625P probably benign Het
Nipsnap2 T C 5: 129,753,218 probably benign Het
Nlrp4e T C 7: 23,320,372 S95P probably benign Het
Olfr1196 T C 2: 88,700,762 D189G probably damaging Het
Olfr378 T A 11: 73,425,827 D52V possibly damaging Het
Otop2 A G 11: 115,329,849 probably null Het
Pcnx4 G C 12: 72,574,400 G998A probably benign Het
Pnkd C A 1: 74,351,522 probably null Het
Ppp4r4 T A 12: 103,606,945 V701E probably benign Het
Ryr2 A G 13: 11,601,841 I3897T probably damaging Het
Scn1a T C 2: 66,332,287 E205G probably damaging Het
Sdk2 G A 11: 113,893,575 probably benign Het
Serpinb5 A T 1: 106,876,052 Q156L probably benign Het
Setdb1 A T 3: 95,327,467 V975D probably benign Het
Shc1 A G 3: 89,428,445 *470W probably null Het
Sik3 T A 9: 46,202,022 V587E probably damaging Het
Sik3 C A 9: 46,221,089 H1276Q probably benign Het
Spata7 T C 12: 98,668,861 I384T probably damaging Het
Tanc2 T A 11: 105,922,137 V1469D probably benign Het
Tdrd5 A T 1: 156,255,802 N888K probably benign Het
Tex22 T C 12: 113,075,380 S34P probably benign Het
Tmed6 T C 8: 107,064,122 T98A probably benign Het
Trim66 G A 7: 109,484,619 P141L probably benign Het
Trpa1 T C 1: 14,885,812 I778V probably benign Het
Urb2 T A 8: 124,028,077 H174Q probably damaging Het
Usb1 T C 8: 95,338,697 V59A probably benign Het
Vmn1r11 T A 6: 57,137,409 N19K probably damaging Het
Vmn1r185 A T 7: 26,611,794 F95L probably benign Het
Vmn1r206 C T 13: 22,620,990 V16M probably benign Het
Vmn2r92 T C 17: 18,167,363 V210A probably benign Het
Wdr17 A T 8: 54,672,501 I448K possibly damaging Het
Zfp768 T A 7: 127,343,561 Q465L probably damaging Het
Zfp804b T A 5: 6,771,105 N617Y probably damaging Het
Other mutations in Magi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01376:Magi1 APN 6 94283093 missense possibly damaging 0.86
IGL01457:Magi1 APN 6 93747224 missense probably damaging 0.99
IGL01642:Magi1 APN 6 93686624 missense possibly damaging 0.69
IGL01724:Magi1 APN 6 93792400 unclassified probably null
IGL01967:Magi1 APN 6 93708134 missense probably damaging 1.00
IGL01984:Magi1 APN 6 93708174 missense probably damaging 1.00
IGL02074:Magi1 APN 6 93745598 missense probably damaging 1.00
IGL02098:Magi1 APN 6 93678787 missense probably damaging 1.00
IGL02225:Magi1 APN 6 93694026 missense probably damaging 1.00
IGL02522:Magi1 APN 6 93678636 missense possibly damaging 0.89
IGL02659:Magi1 APN 6 93785610 missense possibly damaging 0.68
IGL02900:Magi1 APN 6 93686873 missense probably damaging 1.00
P0007:Magi1 UTSW 6 93745988 missense probably damaging 1.00
R0149:Magi1 UTSW 6 93747245 missense probably damaging 1.00
R0512:Magi1 UTSW 6 93694064 missense probably damaging 1.00
R1487:Magi1 UTSW 6 93708079 missense probably benign 0.00
R1502:Magi1 UTSW 6 93694170 missense probably damaging 1.00
R1824:Magi1 UTSW 6 93699639 missense possibly damaging 0.94
R2042:Magi1 UTSW 6 93755045 missense probably benign
R2132:Magi1 UTSW 6 93697274 missense probably damaging 0.99
R2331:Magi1 UTSW 6 93685562 missense probably damaging 1.00
R2418:Magi1 UTSW 6 93745910 missense probably damaging 1.00
R3076:Magi1 UTSW 6 93757687 missense possibly damaging 0.63
R3551:Magi1 UTSW 6 93699629 missense probably damaging 0.98
R4005:Magi1 UTSW 6 93701318 missense probably damaging 1.00
R4455:Magi1 UTSW 6 93785457 missense probably damaging 1.00
R4670:Magi1 UTSW 6 93686643 splice site probably null
R4671:Magi1 UTSW 6 93680787 critical splice donor site probably null
R4839:Magi1 UTSW 6 93694196 missense probably damaging 1.00
R5132:Magi1 UTSW 6 93683091 critical splice acceptor site probably null
R5147:Magi1 UTSW 6 93747267 missense probably damaging 1.00
R5525:Magi1 UTSW 6 93792373 missense possibly damaging 0.95
R5724:Magi1 UTSW 6 93680871 missense probably benign 0.03
R5724:Magi1 UTSW 6 93745701 missense probably damaging 1.00
R5846:Magi1 UTSW 6 93685603 missense probably damaging 1.00
R5896:Magi1 UTSW 6 93708199 missense probably damaging 1.00
R5912:Magi1 UTSW 6 93708145 missense possibly damaging 0.95
R6112:Magi1 UTSW 6 93745590 missense probably damaging 1.00
R6115:Magi1 UTSW 6 93708070 missense possibly damaging 0.64
R6351:Magi1 UTSW 6 93943229 missense possibly damaging 0.82
R6355:Magi1 UTSW 6 94283196 missense probably benign 0.06
R6457:Magi1 UTSW 6 93699639 missense probably damaging 1.00
R6464:Magi1 UTSW 6 93699789 missense probably damaging 1.00
R6613:Magi1 UTSW 6 93745673 missense probably damaging 1.00
R6661:Magi1 UTSW 6 93943308 missense probably benign 0.08
R6755:Magi1 UTSW 6 93708177 missense probably damaging 1.00
R6909:Magi1 UTSW 6 93697320 missense probably damaging 1.00
R7180:Magi1 UTSW 6 93815750 missense probably benign 0.10
R7224:Magi1 UTSW 6 93683089 missense probably benign 0.34
R7447:Magi1 UTSW 6 93745581 missense possibly damaging 0.63
R7517:Magi1 UTSW 6 93708208 missense probably damaging 0.99
R7537:Magi1 UTSW 6 93708110 nonsense probably null
R7549:Magi1 UTSW 6 93708114 missense probably benign 0.19
R7566:Magi1 UTSW 6 93678327 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCACGCATTAGCACCTAACAGGTC -3'
(R):5'- AACAGGATTATGCAGAAGCACCCTC -3'

Sequencing Primer
(F):5'- GGTCCCTAAGGTCAAAGGACTTTC -3'
(R):5'- tcccccgcaagagcaac -3'
Posted On2014-04-13