Incidental Mutation 'R1497:Usb1'
ID168961
Institutional Source Beutler Lab
Gene Symbol Usb1
Ensembl Gene ENSMUSG00000031792
Gene NameU6 snRNA biogenesis 1
SynonymsAA960436
MMRRC Submission 039548-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R1497 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location95332284-95347507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95338697 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 59 (V59A)
Ref Sequence ENSEMBL: ENSMUSP00000122529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034245] [ENSMUST00000126180] [ENSMUST00000213059]
Predicted Effect probably benign
Transcript: ENSMUST00000034245
AA Change: V112A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034245
Gene: ENSMUSG00000031792
AA Change: V112A

DomainStartEndE-ValueType
Pfam:HVSL 45 265 6.3e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126180
AA Change: V59A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000122529
Gene: ENSMUSG00000031792
AA Change: V59A

DomainStartEndE-ValueType
Pfam:HVSL 1 113 6.4e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145060
Predicted Effect probably benign
Transcript: ENSMUST00000213059
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with several conserved domains, however, its exact function is not known. Mutations in this gene are associated with poikiloderma with neutropenia (PN), which shows phenotypic overlap with Rothmund-Thomson syndrome (RTS) caused by mutations in the RECQL4 gene. It is believed that this gene product interacts with RECQL4 protein via SMAD4 proteins, explaining the partial clinical overlap between PN and RTS. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G T 11: 109,973,821 probably benign Het
Abhd17a A G 10: 80,584,330 probably benign Het
Acacb G A 5: 114,196,807 E646K probably damaging Het
Afap1l2 T C 19: 56,928,311 M262V probably benign Het
Anapc7 T A 5: 122,435,515 probably benign Het
Car5b T A X: 163,988,404 K188N probably benign Het
Caskin1 C T 17: 24,504,541 R768* probably null Het
Casp8ap2 T C 4: 32,639,938 S331P probably benign Het
Ccdc68 C T 18: 69,960,514 probably benign Het
Cd44 A T 2: 102,842,955 probably null Het
Celsr3 A G 9: 108,848,865 S3090G probably benign Het
Clasp1 A T 1: 118,552,058 M1023L probably benign Het
Clec16a T C 16: 10,635,259 F608S probably damaging Het
Col7a1 A C 9: 108,978,825 E2531A unknown Het
Ctc1 T A 11: 69,022,561 C128S probably benign Het
Cyp2d41-ps T C 15: 82,782,022 noncoding transcript Het
Cyp2j6 T A 4: 96,531,661 I278F probably damaging Het
Dhtkd1 A T 2: 5,904,113 S723R probably damaging Het
Dhx8 A G 11: 101,735,387 probably benign Het
Dnah17 A T 11: 118,114,233 L775Q probably damaging Het
Dnah8 C A 17: 30,752,075 T2701K probably damaging Het
Eml3 T A 19: 8,936,369 S424R probably damaging Het
Epm2aip1 A G 9: 111,272,247 E96G possibly damaging Het
Ezr T C 17: 6,742,708 H314R probably benign Het
Fam193b G T 13: 55,554,434 H43Q probably damaging Het
Fam208b T C 13: 3,570,409 E2164G probably damaging Het
Fam217a T A 13: 34,911,212 N340I probably damaging Het
Fcrl1 A T 3: 87,384,802 Q89H probably damaging Het
Flg2 A T 3: 93,219,769 H1996L unknown Het
Gabpb1 C T 2: 126,639,249 V327M possibly damaging Het
Gtf3c3 A G 1: 54,437,939 V36A probably benign Het
Hspg2 A G 4: 137,548,096 N2739S probably damaging Het
Hyal1 A G 9: 107,577,995 probably null Het
Ipo13 T C 4: 117,904,659 D448G probably benign Het
Kcnq5 T C 1: 21,402,386 D860G possibly damaging Het
Kif13b A G 14: 64,736,266 N355S probably damaging Het
Kmt2c T A 5: 25,314,515 H2199L possibly damaging Het
Magi1 A G 6: 93,747,329 F235S probably damaging Het
Maml1 A C 11: 50,265,707 M547R possibly damaging Het
Mapk7 T C 11: 61,493,863 K6E possibly damaging Het
Mbd5 T A 2: 49,257,381 N534K possibly damaging Het
Mcat G A 15: 83,549,252 Q34* probably null Het
Mcu T A 10: 59,448,848 D180V probably damaging Het
Mettl21c G T 1: 44,009,791 P199T probably benign Het
Mndal A T 1: 173,872,875 S177T probably benign Het
Mpeg1 G T 19: 12,461,247 C23F probably benign Het
Mup15 T A 4: 61,438,234 Y98F probably benign Het
Myh8 T C 11: 67,289,812 S625P probably benign Het
Nipsnap2 T C 5: 129,753,218 probably benign Het
Nlrp4e T C 7: 23,320,372 S95P probably benign Het
Olfr1196 T C 2: 88,700,762 D189G probably damaging Het
Olfr378 T A 11: 73,425,827 D52V possibly damaging Het
Otop2 A G 11: 115,329,849 probably null Het
Pcnx4 G C 12: 72,574,400 G998A probably benign Het
Pnkd C A 1: 74,351,522 probably null Het
Ppp4r4 T A 12: 103,606,945 V701E probably benign Het
Ryr2 A G 13: 11,601,841 I3897T probably damaging Het
Scn1a T C 2: 66,332,287 E205G probably damaging Het
Sdk2 G A 11: 113,893,575 probably benign Het
Serpinb5 A T 1: 106,876,052 Q156L probably benign Het
Setdb1 A T 3: 95,327,467 V975D probably benign Het
Shc1 A G 3: 89,428,445 *470W probably null Het
Sik3 T A 9: 46,202,022 V587E probably damaging Het
Sik3 C A 9: 46,221,089 H1276Q probably benign Het
Spata7 T C 12: 98,668,861 I384T probably damaging Het
Tanc2 T A 11: 105,922,137 V1469D probably benign Het
Tdrd5 A T 1: 156,255,802 N888K probably benign Het
Tex22 T C 12: 113,075,380 S34P probably benign Het
Tmed6 T C 8: 107,064,122 T98A probably benign Het
Trim66 G A 7: 109,484,619 P141L probably benign Het
Trpa1 T C 1: 14,885,812 I778V probably benign Het
Urb2 T A 8: 124,028,077 H174Q probably damaging Het
Vmn1r11 T A 6: 57,137,409 N19K probably damaging Het
Vmn1r185 A T 7: 26,611,794 F95L probably benign Het
Vmn1r206 C T 13: 22,620,990 V16M probably benign Het
Vmn2r92 T C 17: 18,167,363 V210A probably benign Het
Wdr17 A T 8: 54,672,501 I448K possibly damaging Het
Zfp768 T A 7: 127,343,561 Q465L probably damaging Het
Zfp804b T A 5: 6,771,105 N617Y probably damaging Het
Other mutations in Usb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03164:Usb1 APN 8 95333484 missense probably damaging 1.00
R0276:Usb1 UTSW 8 95333457 missense probably damaging 1.00
R0385:Usb1 UTSW 8 95345318 missense probably damaging 1.00
R0730:Usb1 UTSW 8 95344041 missense probably damaging 1.00
R0801:Usb1 UTSW 8 95333540 splice site probably null
R2230:Usb1 UTSW 8 95344046 missense probably damaging 1.00
R2231:Usb1 UTSW 8 95344046 missense probably damaging 1.00
R2232:Usb1 UTSW 8 95344046 missense probably damaging 1.00
R2402:Usb1 UTSW 8 95343131 missense probably benign 0.06
R2507:Usb1 UTSW 8 95343124 missense probably damaging 1.00
R3821:Usb1 UTSW 8 95333433 missense probably benign 0.35
R5085:Usb1 UTSW 8 95344051 missense probably damaging 0.98
R5834:Usb1 UTSW 8 95333533 utr 3 prime probably benign
R7398:Usb1 UTSW 8 95345303 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATAGGCTACTCCTGGAAGCAGGC -3'
(R):5'- TCACCCTGGATGGGCAGCACAG -3'

Sequencing Primer
(F):5'- CTCCTGGAAGCAGGCTGTAAG -3'
(R):5'- TGCTTGCTGGGCACCAC -3'
Posted On2014-04-13