Incidental Mutation 'R1497:Celsr3'
ID168967
Institutional Source Beutler Lab
Gene Symbol Celsr3
Ensembl Gene ENSMUSG00000023473
Gene Namecadherin, EGF LAG seven-pass G-type receptor 3
SynonymsFmi1, flamingo
MMRRC Submission 039548-MU
Accession Numbers

Genbank: NM_080437; MGI: 1858236 

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1497 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108826320-108852969 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108848865 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 3090 (S3090G)
Ref Sequence ENSEMBL: ENSMUSP00000024238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024238] [ENSMUST00000192507] [ENSMUST00000194079] [ENSMUST00000213524]
Predicted Effect probably benign
Transcript: ENSMUST00000024238
AA Change: S3090G

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000024238
Gene: ENSMUSG00000023473
AA Change: S3090G

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 264 293 N/A INTRINSIC
CA 338 422 2.25e-27 SMART
CA 446 534 5.05e-30 SMART
CA 558 640 7.6e-25 SMART
CA 664 745 7.36e-32 SMART
CA 769 847 5.95e-18 SMART
CA 871 950 5.25e-28 SMART
CA 974 1056 2.67e-29 SMART
CA 1080 1158 1.18e-21 SMART
CA 1186 1262 3.2e-1 SMART
low complexity region 1328 1335 N/A INTRINSIC
low complexity region 1350 1360 N/A INTRINSIC
EGF 1369 1424 1.02e-2 SMART
EGF 1429 1464 3.23e0 SMART
EGF 1467 1503 8.78e-2 SMART
LamG 1524 1691 2.27e-35 SMART
EGF 1714 1747 4.22e-4 SMART
LamG 1774 1913 9.02e-21 SMART
EGF 1938 1971 2.43e-4 SMART
EGF 1973 2009 1.3e-4 SMART
EGF_Lam 2066 2111 5.08e-7 SMART
HormR 2114 2176 3.42e-21 SMART
Pfam:GAIN 2188 2441 1.1e-57 PFAM
GPS 2467 2520 7.92e-20 SMART
Pfam:7tm_2 2527 2758 1.5e-56 PFAM
low complexity region 2813 2829 N/A INTRINSIC
low complexity region 2882 2906 N/A INTRINSIC
low complexity region 3058 3072 N/A INTRINSIC
low complexity region 3149 3189 N/A INTRINSIC
low complexity region 3239 3261 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175326
Predicted Effect probably benign
Transcript: ENSMUST00000192507
SMART Domains Protein: ENSMUSP00000141336
Gene: ENSMUSG00000023259

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 4.1e-33 PFAM
Pfam:Sulfate_transp 176 454 1.9e-67 PFAM
low complexity region 471 484 N/A INTRINSIC
PDB:3LLO|A 489 546 6e-16 PDB
low complexity region 554 593 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193825
Predicted Effect probably benign
Transcript: ENSMUST00000194079
SMART Domains Protein: ENSMUSP00000141789
Gene: ENSMUSG00000023473

DomainStartEndE-ValueType
Pfam:7tm_2 1 185 6.9e-45 PFAM
low complexity region 240 256 N/A INTRINSIC
low complexity region 309 333 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195857
Predicted Effect probably benign
Transcript: ENSMUST00000213524
AA Change: S3098G

PolyPhen 2 Score 0.118 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.17 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the flamingo subfamily, which is included in the cadherin superfamily. The flamingo cadherins consist of nonclassic-type cadherins that do not interact with catenins. They are plasma membrane proteins containing seven epidermal growth factor-like repeats, nine cadherin domains and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic feature of their subfamily. The encoded protein may be involved in the regulation of contact-dependent neurite growth and may play a role in tumor formation. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, abnormal neurvous system development, and abnormal respiratory system development. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G T 11: 109,973,821 probably benign Het
Abhd17a A G 10: 80,584,330 probably benign Het
Acacb G A 5: 114,196,807 E646K probably damaging Het
Afap1l2 T C 19: 56,928,311 M262V probably benign Het
Anapc7 T A 5: 122,435,515 probably benign Het
Car5b T A X: 163,988,404 K188N probably benign Het
Caskin1 C T 17: 24,504,541 R768* probably null Het
Casp8ap2 T C 4: 32,639,938 S331P probably benign Het
Ccdc68 C T 18: 69,960,514 probably benign Het
Cd44 A T 2: 102,842,955 probably null Het
Clasp1 A T 1: 118,552,058 M1023L probably benign Het
Clec16a T C 16: 10,635,259 F608S probably damaging Het
Col7a1 A C 9: 108,978,825 E2531A unknown Het
Ctc1 T A 11: 69,022,561 C128S probably benign Het
Cyp2d41-ps T C 15: 82,782,022 noncoding transcript Het
Cyp2j6 T A 4: 96,531,661 I278F probably damaging Het
Dhtkd1 A T 2: 5,904,113 S723R probably damaging Het
Dhx8 A G 11: 101,735,387 probably benign Het
Dnah17 A T 11: 118,114,233 L775Q probably damaging Het
Dnah8 C A 17: 30,752,075 T2701K probably damaging Het
Eml3 T A 19: 8,936,369 S424R probably damaging Het
Epm2aip1 A G 9: 111,272,247 E96G possibly damaging Het
Ezr T C 17: 6,742,708 H314R probably benign Het
Fam193b G T 13: 55,554,434 H43Q probably damaging Het
Fam208b T C 13: 3,570,409 E2164G probably damaging Het
Fam217a T A 13: 34,911,212 N340I probably damaging Het
Fcrl1 A T 3: 87,384,802 Q89H probably damaging Het
Flg2 A T 3: 93,219,769 H1996L unknown Het
Gabpb1 C T 2: 126,639,249 V327M possibly damaging Het
Gtf3c3 A G 1: 54,437,939 V36A probably benign Het
Hspg2 A G 4: 137,548,096 N2739S probably damaging Het
Hyal1 A G 9: 107,577,995 probably null Het
Ipo13 T C 4: 117,904,659 D448G probably benign Het
Kcnq5 T C 1: 21,402,386 D860G possibly damaging Het
Kif13b A G 14: 64,736,266 N355S probably damaging Het
Kmt2c T A 5: 25,314,515 H2199L possibly damaging Het
Magi1 A G 6: 93,747,329 F235S probably damaging Het
Maml1 A C 11: 50,265,707 M547R possibly damaging Het
Mapk7 T C 11: 61,493,863 K6E possibly damaging Het
Mbd5 T A 2: 49,257,381 N534K possibly damaging Het
Mcat G A 15: 83,549,252 Q34* probably null Het
Mcu T A 10: 59,448,848 D180V probably damaging Het
Mettl21c G T 1: 44,009,791 P199T probably benign Het
Mndal A T 1: 173,872,875 S177T probably benign Het
Mpeg1 G T 19: 12,461,247 C23F probably benign Het
Mup15 T A 4: 61,438,234 Y98F probably benign Het
Myh8 T C 11: 67,289,812 S625P probably benign Het
Nipsnap2 T C 5: 129,753,218 probably benign Het
Nlrp4e T C 7: 23,320,372 S95P probably benign Het
Olfr1196 T C 2: 88,700,762 D189G probably damaging Het
Olfr378 T A 11: 73,425,827 D52V possibly damaging Het
Otop2 A G 11: 115,329,849 probably null Het
Pcnx4 G C 12: 72,574,400 G998A probably benign Het
Pnkd C A 1: 74,351,522 probably null Het
Ppp4r4 T A 12: 103,606,945 V701E probably benign Het
Ryr2 A G 13: 11,601,841 I3897T probably damaging Het
Scn1a T C 2: 66,332,287 E205G probably damaging Het
Sdk2 G A 11: 113,893,575 probably benign Het
Serpinb5 A T 1: 106,876,052 Q156L probably benign Het
Setdb1 A T 3: 95,327,467 V975D probably benign Het
Shc1 A G 3: 89,428,445 *470W probably null Het
Sik3 T A 9: 46,202,022 V587E probably damaging Het
Sik3 C A 9: 46,221,089 H1276Q probably benign Het
Spata7 T C 12: 98,668,861 I384T probably damaging Het
Tanc2 T A 11: 105,922,137 V1469D probably benign Het
Tdrd5 A T 1: 156,255,802 N888K probably benign Het
Tex22 T C 12: 113,075,380 S34P probably benign Het
Tmed6 T C 8: 107,064,122 T98A probably benign Het
Trim66 G A 7: 109,484,619 P141L probably benign Het
Trpa1 T C 1: 14,885,812 I778V probably benign Het
Urb2 T A 8: 124,028,077 H174Q probably damaging Het
Usb1 T C 8: 95,338,697 V59A probably benign Het
Vmn1r11 T A 6: 57,137,409 N19K probably damaging Het
Vmn1r185 A T 7: 26,611,794 F95L probably benign Het
Vmn1r206 C T 13: 22,620,990 V16M probably benign Het
Vmn2r92 T C 17: 18,167,363 V210A probably benign Het
Wdr17 A T 8: 54,672,501 I448K possibly damaging Het
Zfp768 T A 7: 127,343,561 Q465L probably damaging Het
Zfp804b T A 5: 6,771,105 N617Y probably damaging Het
Other mutations in Celsr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Celsr3 APN 9 108848925 missense probably damaging 1.00
IGL00536:Celsr3 APN 9 108829192 missense probably benign 0.33
IGL00552:Celsr3 APN 9 108841263 missense possibly damaging 0.88
IGL00801:Celsr3 APN 9 108842576 missense probably benign
IGL01420:Celsr3 APN 9 108841190 critical splice acceptor site probably null
IGL01541:Celsr3 APN 9 108831708 missense probably damaging 1.00
IGL01619:Celsr3 APN 9 108834557 missense probably damaging 1.00
IGL01619:Celsr3 APN 9 108837404 missense probably benign 0.00
IGL01631:Celsr3 APN 9 108837404 missense probably benign 0.00
IGL01777:Celsr3 APN 9 108835942 missense probably benign 0.08
IGL01938:Celsr3 APN 9 108828415 missense probably benign 0.34
IGL02135:Celsr3 APN 9 108827556 missense probably benign 0.11
IGL02231:Celsr3 APN 9 108842510 missense probably damaging 1.00
IGL02234:Celsr3 APN 9 108829960 missense probably benign
IGL02392:Celsr3 APN 9 108834721 splice site probably benign
IGL02416:Celsr3 APN 9 108832119 missense probably damaging 1.00
IGL02421:Celsr3 APN 9 108840463 missense probably damaging 1.00
IGL02455:Celsr3 APN 9 108842893 missense probably benign 0.15
IGL02798:Celsr3 APN 9 108843575 missense probably damaging 1.00
IGL02939:Celsr3 APN 9 108849453 missense probably damaging 1.00
IGL02947:Celsr3 APN 9 108845935 missense probably benign 0.12
IGL02986:Celsr3 APN 9 108841255 unclassified probably null
IGL03089:Celsr3 APN 9 108826607 missense probably benign 0.04
IGL03162:Celsr3 APN 9 108842558 missense probably damaging 1.00
IGL03267:Celsr3 APN 9 108836525 splice site probably benign
Diminishment UTSW 9 108842708 intron probably benign
little_d UTSW 9 108827692 missense probably damaging 0.98
nogal UTSW 9 108835838 missense probably benign
F6893:Celsr3 UTSW 9 108835067 missense probably benign 0.00
PIT4243001:Celsr3 UTSW 9 108832308 missense probably benign 0.13
PIT4810001:Celsr3 UTSW 9 108845733 missense probably damaging 1.00
R0110:Celsr3 UTSW 9 108827005 missense possibly damaging 0.62
R0243:Celsr3 UTSW 9 108843724 splice site probably benign
R0382:Celsr3 UTSW 9 108829218 missense probably damaging 1.00
R0482:Celsr3 UTSW 9 108829073 nonsense probably null
R0510:Celsr3 UTSW 9 108827005 missense possibly damaging 0.62
R0630:Celsr3 UTSW 9 108827692 missense probably damaging 0.98
R0656:Celsr3 UTSW 9 108834655 missense possibly damaging 0.89
R0764:Celsr3 UTSW 9 108827818 missense probably damaging 1.00
R0883:Celsr3 UTSW 9 108842633 missense probably damaging 1.00
R0924:Celsr3 UTSW 9 108846025 missense possibly damaging 0.78
R1015:Celsr3 UTSW 9 108833176 missense probably benign 0.17
R1321:Celsr3 UTSW 9 108835870 missense probably damaging 1.00
R1423:Celsr3 UTSW 9 108826905 missense probably benign 0.00
R1520:Celsr3 UTSW 9 108848658 missense probably damaging 1.00
R1534:Celsr3 UTSW 9 108848884 missense probably damaging 0.99
R1569:Celsr3 UTSW 9 108829068 missense probably damaging 1.00
R1657:Celsr3 UTSW 9 108842952 nonsense probably null
R1753:Celsr3 UTSW 9 108831857 missense probably damaging 0.99
R1764:Celsr3 UTSW 9 108828958 missense probably damaging 1.00
R1801:Celsr3 UTSW 9 108834626 missense possibly damaging 0.88
R1838:Celsr3 UTSW 9 108829906 missense probably benign
R1839:Celsr3 UTSW 9 108829906 missense probably benign
R1874:Celsr3 UTSW 9 108835838 missense probably benign
R1875:Celsr3 UTSW 9 108835838 missense probably benign
R1953:Celsr3 UTSW 9 108843182 missense probably benign 0.19
R1960:Celsr3 UTSW 9 108845817 missense probably benign
R2113:Celsr3 UTSW 9 108838470 missense probably damaging 1.00
R2290:Celsr3 UTSW 9 108843224 missense probably damaging 1.00
R2369:Celsr3 UTSW 9 108842552 missense probably benign
R2373:Celsr3 UTSW 9 108842552 missense probably benign
R2374:Celsr3 UTSW 9 108842552 missense probably benign
R2375:Celsr3 UTSW 9 108842552 missense probably benign
R2844:Celsr3 UTSW 9 108829308 missense probably damaging 1.00
R2968:Celsr3 UTSW 9 108832191 missense probably damaging 1.00
R3103:Celsr3 UTSW 9 108837139 missense probably benign 0.31
R3159:Celsr3 UTSW 9 108827710 missense possibly damaging 0.94
R3791:Celsr3 UTSW 9 108842552 missense probably benign
R4194:Celsr3 UTSW 9 108843302 critical splice donor site probably null
R4329:Celsr3 UTSW 9 108846049 missense probably benign 0.00
R4365:Celsr3 UTSW 9 108829847 missense possibly damaging 0.47
R4419:Celsr3 UTSW 9 108843244 missense possibly damaging 0.84
R4484:Celsr3 UTSW 9 108846063 critical splice donor site probably null
R4582:Celsr3 UTSW 9 108845723 missense probably damaging 1.00
R4681:Celsr3 UTSW 9 108827754 missense possibly damaging 0.58
R4729:Celsr3 UTSW 9 108847652 missense probably benign 0.05
R4881:Celsr3 UTSW 9 108843941 missense probably damaging 1.00
R4893:Celsr3 UTSW 9 108849421 missense probably damaging 1.00
R5183:Celsr3 UTSW 9 108837560 missense probably damaging 0.99
R5207:Celsr3 UTSW 9 108832759 missense probably benign 0.01
R5290:Celsr3 UTSW 9 108843158 missense probably benign 0.01
R5327:Celsr3 UTSW 9 108842708 intron probably benign
R5345:Celsr3 UTSW 9 108832124 missense probably damaging 1.00
R5358:Celsr3 UTSW 9 108832025 missense possibly damaging 0.96
R5396:Celsr3 UTSW 9 108828582 missense probably damaging 1.00
R5414:Celsr3 UTSW 9 108840042 missense possibly damaging 0.88
R5452:Celsr3 UTSW 9 108844034 missense possibly damaging 0.68
R5467:Celsr3 UTSW 9 108828637 missense probably damaging 1.00
R5479:Celsr3 UTSW 9 108844544 critical splice donor site probably null
R5629:Celsr3 UTSW 9 108849067 missense probably benign 0.41
R5637:Celsr3 UTSW 9 108837133 missense probably damaging 1.00
R5652:Celsr3 UTSW 9 108838472 missense probably benign 0.03
R5739:Celsr3 UTSW 9 108827158 missense probably benign
R5785:Celsr3 UTSW 9 108827797 missense probably damaging 1.00
R5877:Celsr3 UTSW 9 108845727 missense probably damaging 0.98
R5961:Celsr3 UTSW 9 108831794 missense probably damaging 1.00
R6046:Celsr3 UTSW 9 108837151 missense probably benign 0.01
R6176:Celsr3 UTSW 9 108828355 missense probably damaging 1.00
R6291:Celsr3 UTSW 9 108828842 missense probably damaging 1.00
R6468:Celsr3 UTSW 9 108835790 missense probably benign 0.08
R6481:Celsr3 UTSW 9 108837084 missense possibly damaging 0.92
R6547:Celsr3 UTSW 9 108829128 missense probably damaging 1.00
R6763:Celsr3 UTSW 9 108827350 missense probably damaging 1.00
R6870:Celsr3 UTSW 9 108829191 missense probably benign 0.02
R6977:Celsr3 UTSW 9 108827715 missense probably benign
R7061:Celsr3 UTSW 9 108847594 nonsense probably null
R7122:Celsr3 UTSW 9 108828567 missense possibly damaging 0.90
R7156:Celsr3 UTSW 9 108838004 missense possibly damaging 0.95
R7166:Celsr3 UTSW 9 108842951 missense probably damaging 1.00
R7176:Celsr3 UTSW 9 108845762 missense probably benign
R7213:Celsr3 UTSW 9 108849040 missense probably damaging 0.98
R7314:Celsr3 UTSW 9 108829144 missense probably damaging 1.00
R7478:Celsr3 UTSW 9 108843578 missense probably benign 0.37
R7653:Celsr3 UTSW 9 108835070 nonsense probably null
X0018:Celsr3 UTSW 9 108827778 missense possibly damaging 0.65
X0018:Celsr3 UTSW 9 108840412 missense probably benign 0.01
X0026:Celsr3 UTSW 9 108828930 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTCCACAGGCATCCTGAAGAACAG -3'
(R):5'- CTAAGTCCAGTGCATCTCGTGACC -3'

Sequencing Primer
(F):5'- GCATCCTGAAGAACAGGTTGC -3'
(R):5'- GTGCATCTCGTGACCCAAAG -3'
Posted On2014-04-13