Incidental Mutation 'R1497:Spata7'
ID168987
Institutional Source Beutler Lab
Gene Symbol Spata7
Ensembl Gene ENSMUSG00000021007
Gene Namespermatogenesis associated 7
SynonymsB230306G18Rik, HSD3
MMRRC Submission 039548-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R1497 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location98628157-98669815 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98668861 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 384 (I384T)
Ref Sequence ENSEMBL: ENSMUSP00000045827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048402] [ENSMUST00000101144] [ENSMUST00000101146]
Predicted Effect probably damaging
Transcript: ENSMUST00000048402
AA Change: I384T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045827
Gene: ENSMUSG00000021007
AA Change: I384T

DomainStartEndE-ValueType
Pfam:HSD3 9 410 1e-190 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000101144
AA Change: I217T
SMART Domains Protein: ENSMUSP00000098704
Gene: ENSMUSG00000021007
AA Change: I217T

DomainStartEndE-ValueType
Pfam:HSD3 6 131 7.5e-73 PFAM
Pfam:HSD3 122 244 6e-63 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101146
AA Change: I352T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098705
Gene: ENSMUSG00000021007
AA Change: I352T

DomainStartEndE-ValueType
Pfam:HSD3 6 33 1e-11 PFAM
Pfam:HSD3 31 379 2.1e-171 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152482
Meta Mutation Damage Score 0.238 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, originally isolated from testis, is also expressed in retina. Mutations in this gene are associated with Leber congenital amaurosis and juvenile retinitis pigmentosa. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele display progressive retinal rod cell degeneration, a thin retinal outer nuclear layer and impaired scotopic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G T 11: 109,973,821 probably benign Het
Abhd17a A G 10: 80,584,330 probably benign Het
Acacb G A 5: 114,196,807 E646K probably damaging Het
Afap1l2 T C 19: 56,928,311 M262V probably benign Het
Anapc7 T A 5: 122,435,515 probably benign Het
Car5b T A X: 163,988,404 K188N probably benign Het
Caskin1 C T 17: 24,504,541 R768* probably null Het
Casp8ap2 T C 4: 32,639,938 S331P probably benign Het
Ccdc68 C T 18: 69,960,514 probably benign Het
Cd44 A T 2: 102,842,955 probably null Het
Celsr3 A G 9: 108,848,865 S3090G probably benign Het
Clasp1 A T 1: 118,552,058 M1023L probably benign Het
Clec16a T C 16: 10,635,259 F608S probably damaging Het
Col7a1 A C 9: 108,978,825 E2531A unknown Het
Ctc1 T A 11: 69,022,561 C128S probably benign Het
Cyp2d41-ps T C 15: 82,782,022 noncoding transcript Het
Cyp2j6 T A 4: 96,531,661 I278F probably damaging Het
Dhtkd1 A T 2: 5,904,113 S723R probably damaging Het
Dhx8 A G 11: 101,735,387 probably benign Het
Dnah17 A T 11: 118,114,233 L775Q probably damaging Het
Dnah8 C A 17: 30,752,075 T2701K probably damaging Het
Eml3 T A 19: 8,936,369 S424R probably damaging Het
Epm2aip1 A G 9: 111,272,247 E96G possibly damaging Het
Ezr T C 17: 6,742,708 H314R probably benign Het
Fam193b G T 13: 55,554,434 H43Q probably damaging Het
Fam208b T C 13: 3,570,409 E2164G probably damaging Het
Fam217a T A 13: 34,911,212 N340I probably damaging Het
Fcrl1 A T 3: 87,384,802 Q89H probably damaging Het
Flg2 A T 3: 93,219,769 H1996L unknown Het
Gabpb1 C T 2: 126,639,249 V327M possibly damaging Het
Gtf3c3 A G 1: 54,437,939 V36A probably benign Het
Hspg2 A G 4: 137,548,096 N2739S probably damaging Het
Hyal1 A G 9: 107,577,995 probably null Het
Ipo13 T C 4: 117,904,659 D448G probably benign Het
Kcnq5 T C 1: 21,402,386 D860G possibly damaging Het
Kif13b A G 14: 64,736,266 N355S probably damaging Het
Kmt2c T A 5: 25,314,515 H2199L possibly damaging Het
Magi1 A G 6: 93,747,329 F235S probably damaging Het
Maml1 A C 11: 50,265,707 M547R possibly damaging Het
Mapk7 T C 11: 61,493,863 K6E possibly damaging Het
Mbd5 T A 2: 49,257,381 N534K possibly damaging Het
Mcat G A 15: 83,549,252 Q34* probably null Het
Mcu T A 10: 59,448,848 D180V probably damaging Het
Mettl21c G T 1: 44,009,791 P199T probably benign Het
Mndal A T 1: 173,872,875 S177T probably benign Het
Mpeg1 G T 19: 12,461,247 C23F probably benign Het
Mup15 T A 4: 61,438,234 Y98F probably benign Het
Myh8 T C 11: 67,289,812 S625P probably benign Het
Nipsnap2 T C 5: 129,753,218 probably benign Het
Nlrp4e T C 7: 23,320,372 S95P probably benign Het
Olfr1196 T C 2: 88,700,762 D189G probably damaging Het
Olfr378 T A 11: 73,425,827 D52V possibly damaging Het
Otop2 A G 11: 115,329,849 probably null Het
Pcnx4 G C 12: 72,574,400 G998A probably benign Het
Pnkd C A 1: 74,351,522 probably null Het
Ppp4r4 T A 12: 103,606,945 V701E probably benign Het
Ryr2 A G 13: 11,601,841 I3897T probably damaging Het
Scn1a T C 2: 66,332,287 E205G probably damaging Het
Sdk2 G A 11: 113,893,575 probably benign Het
Serpinb5 A T 1: 106,876,052 Q156L probably benign Het
Setdb1 A T 3: 95,327,467 V975D probably benign Het
Shc1 A G 3: 89,428,445 *470W probably null Het
Sik3 T A 9: 46,202,022 V587E probably damaging Het
Sik3 C A 9: 46,221,089 H1276Q probably benign Het
Tanc2 T A 11: 105,922,137 V1469D probably benign Het
Tdrd5 A T 1: 156,255,802 N888K probably benign Het
Tex22 T C 12: 113,075,380 S34P probably benign Het
Tmed6 T C 8: 107,064,122 T98A probably benign Het
Trim66 G A 7: 109,484,619 P141L probably benign Het
Trpa1 T C 1: 14,885,812 I778V probably benign Het
Urb2 T A 8: 124,028,077 H174Q probably damaging Het
Usb1 T C 8: 95,338,697 V59A probably benign Het
Vmn1r11 T A 6: 57,137,409 N19K probably damaging Het
Vmn1r185 A T 7: 26,611,794 F95L probably benign Het
Vmn1r206 C T 13: 22,620,990 V16M probably benign Het
Vmn2r92 T C 17: 18,167,363 V210A probably benign Het
Wdr17 A T 8: 54,672,501 I448K possibly damaging Het
Zfp768 T A 7: 127,343,561 Q465L probably damaging Het
Zfp804b T A 5: 6,771,105 N617Y probably damaging Het
Other mutations in Spata7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00535:Spata7 APN 12 98668840 missense probably damaging 1.00
IGL02283:Spata7 APN 12 98658258 missense probably damaging 0.96
IGL02379:Spata7 APN 12 98634260 missense probably damaging 1.00
R0200:Spata7 UTSW 12 98663169 missense probably benign 0.32
R0422:Spata7 UTSW 12 98658265 missense probably damaging 0.99
R0847:Spata7 UTSW 12 98648430 missense possibly damaging 0.82
R1228:Spata7 UTSW 12 98634269 missense probably damaging 1.00
R1693:Spata7 UTSW 12 98664257 missense possibly damaging 0.85
R2183:Spata7 UTSW 12 98637612 missense probably damaging 1.00
R2507:Spata7 UTSW 12 98658450 missense probably benign
R3176:Spata7 UTSW 12 98637598 missense possibly damaging 0.78
R3177:Spata7 UTSW 12 98637598 missense possibly damaging 0.78
R3276:Spata7 UTSW 12 98637598 missense possibly damaging 0.78
R3277:Spata7 UTSW 12 98637598 missense possibly damaging 0.78
R3951:Spata7 UTSW 12 98669473 missense probably damaging 0.98
R4698:Spata7 UTSW 12 98664277 missense probably damaging 1.00
R4919:Spata7 UTSW 12 98648453 missense possibly damaging 0.65
R5088:Spata7 UTSW 12 98669502 missense probably benign 0.43
R5583:Spata7 UTSW 12 98669331 missense probably damaging 0.98
R6414:Spata7 UTSW 12 98663220 critical splice donor site probably null
R6451:Spata7 UTSW 12 98658337 missense probably benign 0.02
R7167:Spata7 UTSW 12 98664296 missense probably damaging 1.00
R7316:Spata7 UTSW 12 98658612 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCGTAACAGAAGCCAGGCTG -3'
(R):5'- CTGAGGGTCGTTACATTCGCTACAC -3'

Sequencing Primer
(F):5'- CAGAGCAGGAAGGATTTGTTTC -3'
(R):5'- TCGCTACACTATTAAAACTGAACTC -3'
Posted On2014-04-13