Incidental Mutation 'R1505:Ptpn7'
ID169098
Institutional Source Beutler Lab
Gene Symbol Ptpn7
Ensembl Gene ENSMUSG00000031506
Gene Nameprotein tyrosine phosphatase, non-receptor type 7
SynonymsC920001D21Rik, BPTP-4, LC-PTP
MMRRC Submission 040868-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1505 (G1)
Quality Score154
Status Not validated
Chromosome1
Chromosomal Location135132700-135145317 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 135134564 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 83 (T83S)
Ref Sequence ENSEMBL: ENSMUSP00000141133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049449] [ENSMUST00000167080] [ENSMUST00000187985]
Predicted Effect probably benign
Transcript: ENSMUST00000049449
AA Change: T83S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000045803
Gene: ENSMUSG00000031506
AA Change: T83S

DomainStartEndE-ValueType
low complexity region 25 34 N/A INTRINSIC
PTPc 96 351 2.3e-117 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167080
AA Change: T83S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000129474
Gene: ENSMUSG00000031506
AA Change: T83S

DomainStartEndE-ValueType
low complexity region 25 34 N/A INTRINSIC
PTPc 96 351 2.3e-117 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182541
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183317
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183328
Predicted Effect probably benign
Transcript: ENSMUST00000187985
AA Change: T83S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000141133
Gene: ENSMUSG00000031506
AA Change: T83S

DomainStartEndE-ValueType
low complexity region 25 34 N/A INTRINSIC
PTPc 96 351 2.3e-117 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188478
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.5%
  • 20x: 86.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This gene is preferentially expressed in a variety of hematopoietic cells, and is an early response gene in lymphokine stimulated cells. The non-catalytic N-terminus of this PTP can interact with MAP kinases and suppress the MAP kinase activities. This PTP was shown to be involved in the regulation of T cell antigen receptor (TCR) signaling, which was thought to function through dephosphorylating the molecules related to MAP kinase pathway. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T A 5: 104,951,565 R444W probably damaging Het
Adnp A G 2: 168,183,741 S545P possibly damaging Het
Ankrd17 T C 5: 90,300,026 R219G possibly damaging Het
Ap2m1 C G 16: 20,542,697 P372A probably benign Het
Calml3 T A 13: 3,804,071 T45S probably benign Het
Casp8 A G 1: 58,828,922 E174G probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap221 A C 1: 119,953,628 L368R probably benign Het
Chd9 A G 8: 91,006,495 probably null Het
Cnot1 A T 8: 95,728,667 I2035N probably damaging Het
Cyp2c67 T C 19: 39,648,964 R23G probably benign Het
Dnah10 A C 5: 124,754,239 H777P possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam162b G A 10: 51,587,202 A123V probably damaging Het
Golgb1 T A 16: 36,919,643 N2781K possibly damaging Het
Hs2st1 C A 3: 144,434,561 R333L probably benign Het
Kmt2e A G 5: 23,500,535 H1319R probably null Het
Necab1 A T 4: 14,960,047 M300K probably benign Het
Ntrk3 T A 7: 78,460,524 I321F probably damaging Het
Olfr228 A T 2: 86,483,213 H176Q possibly damaging Het
Olfr484 A G 7: 108,124,993 V90A probably benign Het
Olfr860 A T 9: 19,845,788 M277K probably benign Het
Olfr965 A G 9: 39,719,478 N84D probably damaging Het
Osbpl6 T C 2: 76,579,242 S483P probably damaging Het
Pcdhb17 A C 18: 37,486,822 N555T probably damaging Het
Pdgfc G A 3: 81,209,236 R299H possibly damaging Het
Rapgef5 T C 12: 117,688,619 V79A possibly damaging Het
Rexo5 T A 7: 119,799,603 C54* probably null Het
Riok3 A G 18: 12,152,878 K418R probably benign Het
Robo4 G A 9: 37,403,227 G170D probably damaging Het
Rpl8 A G 15: 76,904,410 D33G possibly damaging Het
Rspo2 T C 15: 43,075,843 T184A probably damaging Het
Ryr2 A T 13: 11,554,592 M4942K possibly damaging Het
Sel1l T C 12: 91,813,962 Y585C probably damaging Het
Slc25a11 G T 11: 70,646,824 D13E probably benign Het
Slc5a6 G T 5: 31,037,111 H584N probably benign Het
Snrpf A G 10: 93,583,519 V69A possibly damaging Het
Sorbs3 T A 14: 70,190,802 K475* probably null Het
Speg G A 1: 75,375,542 V35I probably benign Het
Tlk2 T G 11: 105,260,295 V468G probably damaging Het
Trim6 T A 7: 104,232,564 W341R probably damaging Het
Ttll5 T A 12: 85,879,410 I326N probably damaging Het
Vipas39 T C 12: 87,246,160 Y318C probably damaging Het
Vmn1r185 T A 7: 26,611,478 I201F probably damaging Het
Vwce A G 19: 10,664,244 H778R probably benign Het
Zbtb14 C G 17: 69,387,764 I152M probably benign Het
Other mutations in Ptpn7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02282:Ptpn7 APN 1 135134834 missense probably damaging 0.99
IGL02894:Ptpn7 APN 1 135143168 missense probably damaging 0.99
R0486:Ptpn7 UTSW 1 135137358 missense probably damaging 1.00
R0708:Ptpn7 UTSW 1 135134547 missense probably damaging 1.00
R1427:Ptpn7 UTSW 1 135134454 missense possibly damaging 0.63
R1728:Ptpn7 UTSW 1 135134475 missense probably benign
R1729:Ptpn7 UTSW 1 135134475 missense probably benign
R1730:Ptpn7 UTSW 1 135134475 missense probably benign
R1739:Ptpn7 UTSW 1 135134475 missense probably benign
R1762:Ptpn7 UTSW 1 135134475 missense probably benign
R1783:Ptpn7 UTSW 1 135134475 missense probably benign
R1784:Ptpn7 UTSW 1 135134475 missense probably benign
R1785:Ptpn7 UTSW 1 135134475 missense probably benign
R1893:Ptpn7 UTSW 1 135134903 missense probably benign 0.10
R4834:Ptpn7 UTSW 1 135137880 critical splice donor site probably null
R5015:Ptpn7 UTSW 1 135139139 missense possibly damaging 0.82
R5381:Ptpn7 UTSW 1 135143168 missense probably damaging 0.99
R5702:Ptpn7 UTSW 1 135133844 missense probably benign
R6422:Ptpn7 UTSW 1 135134502 missense probably damaging 0.99
R6736:Ptpn7 UTSW 1 135139236 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGGCCTCTAGGTCAAGACAAAGAC -3'
(R):5'- ATGGGGACAACCTCTCTCCTACAC -3'

Sequencing Primer
(F):5'- TCTAGGTCAAGACAAAGACTCAGC -3'
(R):5'- CTACACCCCAAGGAGAAGAGAG -3'
Posted On2014-04-13