Incidental Mutation 'R1505:Pdgfc'
ID169102
Institutional Source Beutler Lab
Gene Symbol Pdgfc
Ensembl Gene ENSMUSG00000028019
Gene Nameplatelet-derived growth factor, C polypeptide
SynonymsPDGF-C, 1110064L01Rik
MMRRC Submission 040868-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1505 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location81036416-81214040 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 81209236 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 299 (R299H)
Ref Sequence ENSEMBL: ENSMUSP00000029652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029652] [ENSMUST00000129285] [ENSMUST00000143721]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029652
AA Change: R299H

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029652
Gene: ENSMUSG00000028019
AA Change: R299H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 46 163 2.43e-23 SMART
low complexity region 172 186 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
PDGF 249 339 3.62e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129285
SMART Domains Protein: ENSMUSP00000118970
Gene: ENSMUSG00000028019

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143721
SMART Domains Protein: ENSMUSP00000122047
Gene: ENSMUSG00000028019

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.5%
  • 20x: 86.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the platelet-derived growth factor family. The four members of this family are mitogenic factors for cells of mesenchymal origin and are characterized by a core motif of eight cysteines. This gene product appears to form only homodimers. It differs from the platelet-derived growth factor alpha and beta polypeptides in having an unusual N-terminal domain, the CUB domain. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous mutation of this gene results neonatal and postnatal lethality with cleft palate, hypoplastic palatine bones, edema, blistering, and a short nasal septum with one allele or abnormal retinal pigmentation with a second allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T A 5: 104,951,565 R444W probably damaging Het
Adnp A G 2: 168,183,741 S545P possibly damaging Het
Ankrd17 T C 5: 90,300,026 R219G possibly damaging Het
Ap2m1 C G 16: 20,542,697 P372A probably benign Het
Calml3 T A 13: 3,804,071 T45S probably benign Het
Casp8 A G 1: 58,828,922 E174G probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap221 A C 1: 119,953,628 L368R probably benign Het
Chd9 A G 8: 91,006,495 probably null Het
Cnot1 A T 8: 95,728,667 I2035N probably damaging Het
Cyp2c67 T C 19: 39,648,964 R23G probably benign Het
Dnah10 A C 5: 124,754,239 H777P possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam162b G A 10: 51,587,202 A123V probably damaging Het
Golgb1 T A 16: 36,919,643 N2781K possibly damaging Het
Hs2st1 C A 3: 144,434,561 R333L probably benign Het
Kmt2e A G 5: 23,500,535 H1319R probably null Het
Necab1 A T 4: 14,960,047 M300K probably benign Het
Ntrk3 T A 7: 78,460,524 I321F probably damaging Het
Olfr228 A T 2: 86,483,213 H176Q possibly damaging Het
Olfr484 A G 7: 108,124,993 V90A probably benign Het
Olfr860 A T 9: 19,845,788 M277K probably benign Het
Olfr965 A G 9: 39,719,478 N84D probably damaging Het
Osbpl6 T C 2: 76,579,242 S483P probably damaging Het
Pcdhb17 A C 18: 37,486,822 N555T probably damaging Het
Ptpn7 A T 1: 135,134,564 T83S probably benign Het
Rapgef5 T C 12: 117,688,619 V79A possibly damaging Het
Rexo5 T A 7: 119,799,603 C54* probably null Het
Riok3 A G 18: 12,152,878 K418R probably benign Het
Robo4 G A 9: 37,403,227 G170D probably damaging Het
Rpl8 A G 15: 76,904,410 D33G possibly damaging Het
Rspo2 T C 15: 43,075,843 T184A probably damaging Het
Ryr2 A T 13: 11,554,592 M4942K possibly damaging Het
Sel1l T C 12: 91,813,962 Y585C probably damaging Het
Slc25a11 G T 11: 70,646,824 D13E probably benign Het
Slc5a6 G T 5: 31,037,111 H584N probably benign Het
Snrpf A G 10: 93,583,519 V69A possibly damaging Het
Sorbs3 T A 14: 70,190,802 K475* probably null Het
Speg G A 1: 75,375,542 V35I probably benign Het
Tlk2 T G 11: 105,260,295 V468G probably damaging Het
Trim6 T A 7: 104,232,564 W341R probably damaging Het
Ttll5 T A 12: 85,879,410 I326N probably damaging Het
Vipas39 T C 12: 87,246,160 Y318C probably damaging Het
Vmn1r185 T A 7: 26,611,478 I201F probably damaging Het
Vwce A G 19: 10,664,244 H778R probably benign Het
Zbtb14 C G 17: 69,387,764 I152M probably benign Het
Other mutations in Pdgfc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Pdgfc APN 3 81141443 missense probably benign 0.01
IGL01467:Pdgfc APN 3 81209091 missense probably damaging 1.00
IGL01897:Pdgfc APN 3 81204332 missense possibly damaging 0.71
IGL02732:Pdgfc APN 3 81037557 splice site probably benign
R1619:Pdgfc UTSW 3 81174887 missense probably benign 0.03
R1964:Pdgfc UTSW 3 81174985 missense probably benign 0.34
R1975:Pdgfc UTSW 3 81209245 missense probably damaging 0.99
R1977:Pdgfc UTSW 3 81209245 missense probably damaging 0.99
R3705:Pdgfc UTSW 3 81204444 critical splice donor site probably null
R3775:Pdgfc UTSW 3 81141551 missense probably damaging 1.00
R3776:Pdgfc UTSW 3 81141551 missense probably damaging 1.00
R4381:Pdgfc UTSW 3 81209251 missense probably damaging 1.00
R4504:Pdgfc UTSW 3 81174991 missense probably benign
R4583:Pdgfc UTSW 3 81141528 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GCATAATCAGATGCAAGGCATGAGC -3'
(R):5'- GTTAGGTTGGACAGTAACGGGACAC -3'

Sequencing Primer
(F):5'- GGTGAATCTGAATCTCCTCAAGG -3'
(R):5'- TGTGCCTTAAATGAAAGGCCC -3'
Posted On2014-04-13