Incidental Mutation 'R1505:Hs2st1'
ID169103
Institutional Source Beutler Lab
Gene Symbol Hs2st1
Ensembl Gene ENSMUSG00000040151
Gene Nameheparan sulfate 2-O-sulfotransferase 1
SynonymsHs2st
MMRRC Submission 040868-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.258) question?
Stock #R1505 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location144429706-144570181 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 144434561 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 333 (R333L)
Ref Sequence ENSEMBL: ENSMUSP00000043066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043325]
Predicted Effect probably benign
Transcript: ENSMUST00000043325
AA Change: R333L

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000043066
Gene: ENSMUSG00000040151
AA Change: R333L

DomainStartEndE-ValueType
coiled coil region 21 58 N/A INTRINSIC
Pfam:Sulfotransfer_2 66 327 9.1e-44 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.5%
  • 20x: 86.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heparan sulfate biosynthetic enzymes are key components in generating a myriad of distinct heparan sulfate fine structures that carry out multiple biologic activities. This gene encodes a member of the heparan sulfate biosynthetic enzyme family that transfers sulfate to the 2 position of the iduronic acid residue of heparan sulfate. The disruption of this gene resulted in no kidney formation in knockout embryonic mice, indicating that the absence of this enzyme may interfere with the signaling required for kidney formation. Two alternatively spliced transcript variants that encode different proteins have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: A mutation in this gene causes bilateral renal agenesis, bone defects, eye development abnormalities and cataracts in homozygous mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T A 5: 104,951,565 R444W probably damaging Het
Adnp A G 2: 168,183,741 S545P possibly damaging Het
Ankrd17 T C 5: 90,300,026 R219G possibly damaging Het
Ap2m1 C G 16: 20,542,697 P372A probably benign Het
Calml3 T A 13: 3,804,071 T45S probably benign Het
Casp8 A G 1: 58,828,922 E174G probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap221 A C 1: 119,953,628 L368R probably benign Het
Chd9 A G 8: 91,006,495 probably null Het
Cnot1 A T 8: 95,728,667 I2035N probably damaging Het
Cyp2c67 T C 19: 39,648,964 R23G probably benign Het
Dnah10 A C 5: 124,754,239 H777P possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam162b G A 10: 51,587,202 A123V probably damaging Het
Golgb1 T A 16: 36,919,643 N2781K possibly damaging Het
Kmt2e A G 5: 23,500,535 H1319R probably null Het
Necab1 A T 4: 14,960,047 M300K probably benign Het
Ntrk3 T A 7: 78,460,524 I321F probably damaging Het
Olfr228 A T 2: 86,483,213 H176Q possibly damaging Het
Olfr484 A G 7: 108,124,993 V90A probably benign Het
Olfr860 A T 9: 19,845,788 M277K probably benign Het
Olfr965 A G 9: 39,719,478 N84D probably damaging Het
Osbpl6 T C 2: 76,579,242 S483P probably damaging Het
Pcdhb17 A C 18: 37,486,822 N555T probably damaging Het
Pdgfc G A 3: 81,209,236 R299H possibly damaging Het
Ptpn7 A T 1: 135,134,564 T83S probably benign Het
Rapgef5 T C 12: 117,688,619 V79A possibly damaging Het
Rexo5 T A 7: 119,799,603 C54* probably null Het
Riok3 A G 18: 12,152,878 K418R probably benign Het
Robo4 G A 9: 37,403,227 G170D probably damaging Het
Rpl8 A G 15: 76,904,410 D33G possibly damaging Het
Rspo2 T C 15: 43,075,843 T184A probably damaging Het
Ryr2 A T 13: 11,554,592 M4942K possibly damaging Het
Sel1l T C 12: 91,813,962 Y585C probably damaging Het
Slc25a11 G T 11: 70,646,824 D13E probably benign Het
Slc5a6 G T 5: 31,037,111 H584N probably benign Het
Snrpf A G 10: 93,583,519 V69A possibly damaging Het
Sorbs3 T A 14: 70,190,802 K475* probably null Het
Speg G A 1: 75,375,542 V35I probably benign Het
Tlk2 T G 11: 105,260,295 V468G probably damaging Het
Trim6 T A 7: 104,232,564 W341R probably damaging Het
Ttll5 T A 12: 85,879,410 I326N probably damaging Het
Vipas39 T C 12: 87,246,160 Y318C probably damaging Het
Vmn1r185 T A 7: 26,611,478 I201F probably damaging Het
Vwce A G 19: 10,664,244 H778R probably benign Het
Zbtb14 C G 17: 69,387,764 I152M probably benign Het
Other mutations in Hs2st1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0037:Hs2st1 UTSW 3 144437644 nonsense probably null
R1215:Hs2st1 UTSW 3 144465141 missense possibly damaging 0.75
R1450:Hs2st1 UTSW 3 144434718 splice site probably benign
R1474:Hs2st1 UTSW 3 144435495 missense possibly damaging 0.94
R1695:Hs2st1 UTSW 3 144434654 missense probably benign 0.00
R2511:Hs2st1 UTSW 3 144569930 unclassified probably benign
R2967:Hs2st1 UTSW 3 144465138 missense probably damaging 1.00
R3928:Hs2st1 UTSW 3 144434628 missense possibly damaging 0.55
R4895:Hs2st1 UTSW 3 144465253 missense probably benign
R4911:Hs2st1 UTSW 3 144465082 missense probably benign 0.23
R5477:Hs2st1 UTSW 3 144556948 critical splice donor site probably benign
R5666:Hs2st1 UTSW 3 144569793 missense probably damaging 0.97
R6262:Hs2st1 UTSW 3 144434613 missense probably damaging 0.96
X0019:Hs2st1 UTSW 3 144454012 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GCAATGTAAGTCCCCATGTCCCTG -3'
(R):5'- ACCTTGTAATGGTGCTGCCTCG -3'

Sequencing Primer
(F):5'- ATGTCCCTGCACCAGGAG -3'
(R):5'- CCACTTCTTCAAGTAAAGAGGC -3'
Posted On2014-04-13