Incidental Mutation 'R1505:Fabp3'
ID169105
Institutional Source Beutler Lab
Gene Symbol Fabp3
Ensembl Gene ENSMUSG00000028773
Gene Namefatty acid binding protein 3, muscle and heart
SynonymsFabph4, Mdgi, H-FABP, Fabp3, Fabph1, Fabph-4, Fabph-1
MMRRC Submission 040868-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1505 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location130308595-130315463 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 130312387 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 57 (T57I)
Ref Sequence ENSEMBL: ENSMUSP00000070709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070532] [ENSMUST00000097865] [ENSMUST00000134159]
Predicted Effect probably benign
Transcript: ENSMUST00000070532
AA Change: T57I

PolyPhen 2 Score 0.208 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000070709
Gene: ENSMUSG00000028773
AA Change: T57I

DomainStartEndE-ValueType
Pfam:Lipocalin_7 3 133 3.2e-13 PFAM
Pfam:Lipocalin 6 132 4.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097865
SMART Domains Protein: ENSMUSP00000095477
Gene: ENSMUSG00000073752

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134159
SMART Domains Protein: ENSMUSP00000120807
Gene: ENSMUSG00000028772

DomainStartEndE-ValueType
S1 14 86 4.47e-11 SMART
ZnF_C2HC 132 148 4.56e-1 SMART
low complexity region 160 171 N/A INTRINSIC
low complexity region 182 211 N/A INTRINSIC
low complexity region 227 240 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149755
Meta Mutation Damage Score 0.714 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.5%
  • 20x: 86.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The intracellular fatty acid-binding proteins (FABPs) belongs to a multigene family. FABPs are divided into at least three distinct types, namely the hepatic-, intestinal- and cardiac-type. They form 14-15 kDa proteins and are thought to participate in the uptake, intracellular metabolism and/or transport of long-chain fatty acids. They may also be responsible in the modulation of cell growth and proliferation. Fatty acid-binding protein 3 gene contains four exons and its function is to arrest growth of mammary epithelial cells. This gene is a candidate tumor suppressor gene for human breast cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Inactivation of this locus results in impaired fatty acid utilization. Homozygous null mice show exercise intolerance and cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T A 5: 104,951,565 R444W probably damaging Het
Adnp A G 2: 168,183,741 S545P possibly damaging Het
Ankrd17 T C 5: 90,300,026 R219G possibly damaging Het
Ap2m1 C G 16: 20,542,697 P372A probably benign Het
Calml3 T A 13: 3,804,071 T45S probably benign Het
Casp8 A G 1: 58,828,922 E174G probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap221 A C 1: 119,953,628 L368R probably benign Het
Chd9 A G 8: 91,006,495 probably null Het
Cnot1 A T 8: 95,728,667 I2035N probably damaging Het
Cyp2c67 T C 19: 39,648,964 R23G probably benign Het
Dnah10 A C 5: 124,754,239 H777P possibly damaging Het
Fam162b G A 10: 51,587,202 A123V probably damaging Het
Golgb1 T A 16: 36,919,643 N2781K possibly damaging Het
Hs2st1 C A 3: 144,434,561 R333L probably benign Het
Kmt2e A G 5: 23,500,535 H1319R probably null Het
Necab1 A T 4: 14,960,047 M300K probably benign Het
Ntrk3 T A 7: 78,460,524 I321F probably damaging Het
Olfr228 A T 2: 86,483,213 H176Q possibly damaging Het
Olfr484 A G 7: 108,124,993 V90A probably benign Het
Olfr860 A T 9: 19,845,788 M277K probably benign Het
Olfr965 A G 9: 39,719,478 N84D probably damaging Het
Osbpl6 T C 2: 76,579,242 S483P probably damaging Het
Pcdhb17 A C 18: 37,486,822 N555T probably damaging Het
Pdgfc G A 3: 81,209,236 R299H possibly damaging Het
Ptpn7 A T 1: 135,134,564 T83S probably benign Het
Rapgef5 T C 12: 117,688,619 V79A possibly damaging Het
Rexo5 T A 7: 119,799,603 C54* probably null Het
Riok3 A G 18: 12,152,878 K418R probably benign Het
Robo4 G A 9: 37,403,227 G170D probably damaging Het
Rpl8 A G 15: 76,904,410 D33G possibly damaging Het
Rspo2 T C 15: 43,075,843 T184A probably damaging Het
Ryr2 A T 13: 11,554,592 M4942K possibly damaging Het
Sel1l T C 12: 91,813,962 Y585C probably damaging Het
Slc25a11 G T 11: 70,646,824 D13E probably benign Het
Slc5a6 G T 5: 31,037,111 H584N probably benign Het
Snrpf A G 10: 93,583,519 V69A possibly damaging Het
Sorbs3 T A 14: 70,190,802 K475* probably null Het
Speg G A 1: 75,375,542 V35I probably benign Het
Tlk2 T G 11: 105,260,295 V468G probably damaging Het
Trim6 T A 7: 104,232,564 W341R probably damaging Het
Ttll5 T A 12: 85,879,410 I326N probably damaging Het
Vipas39 T C 12: 87,246,160 Y318C probably damaging Het
Vmn1r185 T A 7: 26,611,478 I201F probably damaging Het
Vwce A G 19: 10,664,244 H778R probably benign Het
Zbtb14 C G 17: 69,387,764 I152M probably benign Het
Other mutations in Fabp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
cardio UTSW 4 130312387 missense probably benign 0.21
R1111:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1112:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1114:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1116:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1144:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1146:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1146:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1147:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1147:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1460:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1506:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1508:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1509:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1582:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1601:Fabp3 UTSW 4 130308848 missense probably benign 0.24
R1612:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1641:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1664:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1670:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1686:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1690:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1709:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1854:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1855:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1935:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2107:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2208:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2211:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2392:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2393:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2829:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2830:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2831:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2901:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2964:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2975:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2979:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2980:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2981:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2982:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2983:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R3430:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R3612:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R3613:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R3614:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R3755:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R3756:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R3825:Fabp3 UTSW 4 130312452 unclassified probably null
R3842:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4012:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4280:Fabp3 UTSW 4 130312452 unclassified probably null
R4282:Fabp3 UTSW 4 130312452 unclassified probably null
R4405:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4406:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4466:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4503:Fabp3 UTSW 4 130312452 unclassified probably null
R4547:Fabp3 UTSW 4 130312452 unclassified probably null
R4548:Fabp3 UTSW 4 130312452 unclassified probably null
R4671:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4681:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4710:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4743:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4850:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4989:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R5015:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R5133:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R5134:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R5549:Fabp3 UTSW 4 130315225 makesense probably null
R5884:Fabp3 UTSW 4 130312338 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTACAAAATCTTCCAGGGGCAGGAC -3'
(R):5'- GCAGCACTGAGCAGGCTTTATGAAC -3'

Sequencing Primer
(F):5'- CAAAGACGTGGGCCACTG -3'
(R):5'- AGGCTTTATGAACCTGCCC -3'
Posted On2014-04-13