Incidental Mutation 'R1505:Vmn1r185'
ID169112
Institutional Source Beutler Lab
Gene Symbol Vmn1r185
Ensembl Gene ENSMUSG00000091924
Gene Namevomeronasal 1 receptor 185
SynonymsV1re12
MMRRC Submission 040868-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.224) question?
Stock #R1505 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location26607636-26618464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26611478 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 201 (I201F)
Ref Sequence ENSEMBL: ENSMUSP00000154688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171039] [ENSMUST00000226694] [ENSMUST00000227264] [ENSMUST00000227411] [ENSMUST00000227461] [ENSMUST00000227479] [ENSMUST00000227695] [ENSMUST00000228004] [ENSMUST00000228133] [ENSMUST00000228367] [ENSMUST00000228467] [ENSMUST00000228633] [ENSMUST00000228676]
Predicted Effect probably damaging
Transcript: ENSMUST00000171039
AA Change: I201F

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128295
Gene: ENSMUSG00000091924
AA Change: I201F

DomainStartEndE-ValueType
Pfam:TAS2R 7 307 4.1e-8 PFAM
Pfam:V1R 38 297 1.5e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000226694
AA Change: I201F

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000227264
AA Change: I201F

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000227411
AA Change: I201F

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000227461
AA Change: I201F

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000227479
AA Change: I201F

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000227695
AA Change: I201F

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000228004
AA Change: I201F

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000228133
AA Change: I201F

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000228367
AA Change: I201F

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000228467
AA Change: I201F

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000228633
AA Change: I201F

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000228676
AA Change: I201F

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.5%
  • 20x: 86.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T A 5: 104,951,565 R444W probably damaging Het
Adnp A G 2: 168,183,741 S545P possibly damaging Het
Ankrd17 T C 5: 90,300,026 R219G possibly damaging Het
Ap2m1 C G 16: 20,542,697 P372A probably benign Het
Calml3 T A 13: 3,804,071 T45S probably benign Het
Casp8 A G 1: 58,828,922 E174G probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap221 A C 1: 119,953,628 L368R probably benign Het
Chd9 A G 8: 91,006,495 probably null Het
Cnot1 A T 8: 95,728,667 I2035N probably damaging Het
Cyp2c67 T C 19: 39,648,964 R23G probably benign Het
Dnah10 A C 5: 124,754,239 H777P possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam162b G A 10: 51,587,202 A123V probably damaging Het
Golgb1 T A 16: 36,919,643 N2781K possibly damaging Het
Hs2st1 C A 3: 144,434,561 R333L probably benign Het
Kmt2e A G 5: 23,500,535 H1319R probably null Het
Necab1 A T 4: 14,960,047 M300K probably benign Het
Ntrk3 T A 7: 78,460,524 I321F probably damaging Het
Olfr228 A T 2: 86,483,213 H176Q possibly damaging Het
Olfr484 A G 7: 108,124,993 V90A probably benign Het
Olfr860 A T 9: 19,845,788 M277K probably benign Het
Olfr965 A G 9: 39,719,478 N84D probably damaging Het
Osbpl6 T C 2: 76,579,242 S483P probably damaging Het
Pcdhb17 A C 18: 37,486,822 N555T probably damaging Het
Pdgfc G A 3: 81,209,236 R299H possibly damaging Het
Ptpn7 A T 1: 135,134,564 T83S probably benign Het
Rapgef5 T C 12: 117,688,619 V79A possibly damaging Het
Rexo5 T A 7: 119,799,603 C54* probably null Het
Riok3 A G 18: 12,152,878 K418R probably benign Het
Robo4 G A 9: 37,403,227 G170D probably damaging Het
Rpl8 A G 15: 76,904,410 D33G possibly damaging Het
Rspo2 T C 15: 43,075,843 T184A probably damaging Het
Ryr2 A T 13: 11,554,592 M4942K possibly damaging Het
Sel1l T C 12: 91,813,962 Y585C probably damaging Het
Slc25a11 G T 11: 70,646,824 D13E probably benign Het
Slc5a6 G T 5: 31,037,111 H584N probably benign Het
Snrpf A G 10: 93,583,519 V69A possibly damaging Het
Sorbs3 T A 14: 70,190,802 K475* probably null Het
Speg G A 1: 75,375,542 V35I probably benign Het
Tlk2 T G 11: 105,260,295 V468G probably damaging Het
Trim6 T A 7: 104,232,564 W341R probably damaging Het
Ttll5 T A 12: 85,879,410 I326N probably damaging Het
Vipas39 T C 12: 87,246,160 Y318C probably damaging Het
Vwce A G 19: 10,664,244 H778R probably benign Het
Zbtb14 C G 17: 69,387,764 I152M probably benign Het
Other mutations in Vmn1r185
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Vmn1r185 APN 7 26611190 missense probably benign 0.00
IGL00938:Vmn1r185 APN 7 26611691 missense probably benign
IGL01413:Vmn1r185 APN 7 26611621 missense probably damaging 0.99
R0207:Vmn1r185 UTSW 7 26611589 missense possibly damaging 0.80
R1497:Vmn1r185 UTSW 7 26611794 missense probably benign 0.01
R1966:Vmn1r185 UTSW 7 26611531 missense probably benign 0.31
R2022:Vmn1r185 UTSW 7 26611510 missense possibly damaging 0.86
R4010:Vmn1r185 UTSW 7 26612025 missense possibly damaging 0.77
R4093:Vmn1r185 UTSW 7 26611783 missense probably damaging 1.00
R4095:Vmn1r185 UTSW 7 26611783 missense probably damaging 1.00
R4961:Vmn1r185 UTSW 7 26611291 missense probably benign 0.43
R5049:Vmn1r185 UTSW 7 26611495 missense possibly damaging 0.95
R6297:Vmn1r185 UTSW 7 26611621 missense probably benign 0.10
R6903:Vmn1r185 UTSW 7 26611735 missense probably damaging 1.00
X0063:Vmn1r185 UTSW 7 26611903 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCTCATGTAGGCTGCTAACTCG -3'
(R):5'- AGCCCCAGAAAATCCTGTTGGAAG -3'

Sequencing Primer
(F):5'- TTTGGACAAGGTGCTACCAC -3'
(R):5'- CCTGTTGGAAGGATCATAAAGTC -3'
Posted On2014-04-13