Mutagenetix > Incidental Mutation

Incidental Mutation 'R1505:Cnot1'

169117

Institutional Source

Beutler Lab

Gene Symbol

Cnot1

Ensembl Gene

ENSMUSG00000036550

Gene Name

CCR4-NOT transcription complex, subunit 1

Synonyms

6030411K04Rik

MMRRC Submission

040868-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1505 (G1)

Quality Score

153

Status

Not validated

Chromosome

Chromosomal Location

96446079-96534092 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 96455295 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 2035 (I2035N)

Ref Sequence

ENSEMBL: ENSMUSP00000148807 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000068452
AA Change: I2037N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: I2037N

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
PDB:4J8S\|A	798	999	1e-137	PDB
low complexity region	1011	1028	N/A	INTRINSIC
low complexity region	1031	1055	N/A	INTRINSIC
PDB:4CT4\|C	1056	1295	1e-148	PDB
low complexity region	1296	1308	N/A	INTRINSIC
low complexity region	1328	1345	N/A	INTRINSIC
Pfam:DUF3819	1381	1530	2.5e-56	PFAM
low complexity region	1634	1648	N/A	INTRINSIC
Pfam:Not1	1991	2305	2.4e-125	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000098473
AA Change: I2042N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: I2042N

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
Pfam:CNOT1_HEAT	500	656	2.4e-57	PFAM
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
Pfam:CNOT1_TTP_bind	812	1004	1.4e-87	PFAM
low complexity region	1016	1033	N/A	INTRINSIC
low complexity region	1036	1060	N/A	INTRINSIC
Pfam:CNOT1_CAF1_bind	1087	1313	5.7e-99	PFAM
low complexity region	1333	1350	N/A	INTRINSIC
Pfam:DUF3819	1387	1534	2.3e-57	PFAM
low complexity region	1639	1653	N/A	INTRINSIC
Pfam:Not1	1998	2357	5.7e-157	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000211887
AA Change: I2035N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212302

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212369

Predicted Effect

probably benign
Transcript: ENSMUST00000212415

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212535

Predicted Effect

probably benign
Transcript: ENSMUST00000213006

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 94.5%
20x: 86.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg3	T	A	5: 105,099,431 (GRCm39)	R444W	probably damaging	Het
Adnp	A	G	2: 168,025,661 (GRCm39)	S545P	possibly damaging	Het
Ankrd17	T	C	5: 90,447,885 (GRCm39)	R219G	possibly damaging	Het
Ap2m1	C	G	16: 20,361,447 (GRCm39)	P372A	probably benign	Het
Calml3	T	A	13: 3,854,071 (GRCm39)	T45S	probably benign	Het
Casp8	A	G	1: 58,868,081 (GRCm39)	E174G	probably damaging	Het
Ces4a	G	A	8: 105,864,729 (GRCm39)	G69S	probably damaging	Het
Cfap221	A	C	1: 119,881,358 (GRCm39)	L368R	probably benign	Het
Chd9	A	G	8: 91,733,123 (GRCm39)		probably null	Het
Cyp2c67	T	C	19: 39,637,408 (GRCm39)	R23G	probably benign	Het
Dnah10	A	C	5: 124,831,303 (GRCm39)	H777P	possibly damaging	Het
Fabp3	C	T	4: 130,206,180 (GRCm39)	T57I	probably benign	Het
Fam162b	G	A	10: 51,463,298 (GRCm39)	A123V	probably damaging	Het
Golgb1	T	A	16: 36,740,005 (GRCm39)	N2781K	possibly damaging	Het
Hs2st1	C	A	3: 144,140,322 (GRCm39)	R333L	probably benign	Het
Kmt2e	A	G	5: 23,705,533 (GRCm39)	H1319R	probably null	Het
Necab1	A	T	4: 14,960,047 (GRCm39)	M300K	probably benign	Het
Ntrk3	T	A	7: 78,110,272 (GRCm39)	I321F	probably damaging	Het
Or5p60	A	G	7: 107,724,200 (GRCm39)	V90A	probably benign	Het
Or7e169	A	T	9: 19,757,084 (GRCm39)	M277K	probably benign	Het
Or8g52	A	G	9: 39,630,774 (GRCm39)	N84D	probably damaging	Het
Or8k41	A	T	2: 86,313,557 (GRCm39)	H176Q	possibly damaging	Het
Osbpl6	T	C	2: 76,409,586 (GRCm39)	S483P	probably damaging	Het
Pcdhb17	A	C	18: 37,619,875 (GRCm39)	N555T	probably damaging	Het
Pdgfc	G	A	3: 81,116,543 (GRCm39)	R299H	possibly damaging	Het
Ptpn7	A	T	1: 135,062,302 (GRCm39)	T83S	probably benign	Het
Rapgef5	T	C	12: 117,652,354 (GRCm39)	V79A	possibly damaging	Het
Rexo5	T	A	7: 119,398,826 (GRCm39)	C54*	probably null	Het
Riok3	A	G	18: 12,285,935 (GRCm39)	K418R	probably benign	Het
Robo4	G	A	9: 37,314,523 (GRCm39)	G170D	probably damaging	Het
Rpl8	A	G	15: 76,788,610 (GRCm39)	D33G	possibly damaging	Het
Rspo2	T	C	15: 42,939,239 (GRCm39)	T184A	probably damaging	Het
Ryr2	A	T	13: 11,569,478 (GRCm39)	M4942K	possibly damaging	Het
Sel1l	T	C	12: 91,780,736 (GRCm39)	Y585C	probably damaging	Het
Slc25a11	G	T	11: 70,537,650 (GRCm39)	D13E	probably benign	Het
Slc5a6	G	T	5: 31,194,455 (GRCm39)	H584N	probably benign	Het
Snrpf	A	G	10: 93,419,381 (GRCm39)	V69A	possibly damaging	Het
Sorbs3	T	A	14: 70,428,251 (GRCm39)	K475*	probably null	Het
Speg	G	A	1: 75,352,186 (GRCm39)	V35I	probably benign	Het
Tlk2	T	G	11: 105,151,121 (GRCm39)	V468G	probably damaging	Het
Trim6	T	A	7: 103,881,771 (GRCm39)	W341R	probably damaging	Het
Ttll5	T	A	12: 85,926,184 (GRCm39)	I326N	probably damaging	Het
Vipas39	T	C	12: 87,292,934 (GRCm39)	Y318C	probably damaging	Het
Vmn1r185	T	A	7: 26,310,903 (GRCm39)	I201F	probably damaging	Het
Vwce	A	G	19: 10,641,608 (GRCm39)	H778R	probably benign	Het
Zbtb14	C	G	17: 69,694,759 (GRCm39)	I152M	probably benign	Het

Other mutations in Cnot1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Cnot1	APN	8	96,452,707 (GRCm39)	missense	probably damaging	1.00
IGL01340:Cnot1	APN	8	96,487,165 (GRCm39)	missense	probably damaging	1.00
IGL01457:Cnot1	APN	8	96,467,637 (GRCm39)	missense	probably damaging	1.00
IGL01505:Cnot1	APN	8	96,455,346 (GRCm39)	missense	probably damaging	0.98
IGL02401:Cnot1	APN	8	96,482,761 (GRCm39)	missense	possibly damaging	0.95
IGL02693:Cnot1	APN	8	96,500,113 (GRCm39)	missense	probably damaging	1.00
IGL02696:Cnot1	APN	8	96,471,645 (GRCm39)	missense	probably benign	0.00
IGL02754:Cnot1	APN	8	96,481,706 (GRCm39)	missense	probably benign	0.03
IGL03092:Cnot1	APN	8	96,496,243 (GRCm39)	intron	probably benign
IGL03174:Cnot1	APN	8	96,487,983 (GRCm39)	missense	probably damaging	1.00
IGL03310:Cnot1	APN	8	96,462,308 (GRCm39)	splice site	probably benign
IGL03371:Cnot1	APN	8	96,501,344 (GRCm39)	missense	possibly damaging	0.85
Affiliate	UTSW	8	96,491,753 (GRCm39)	missense	probably damaging	0.99
Barge	UTSW	8	96,460,757 (GRCm39)	missense	probably benign	0.13
Byproduct	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
Chairman	UTSW	8	96,491,655 (GRCm39)	missense	possibly damaging	0.95
cohort	UTSW	8	96,462,377 (GRCm39)	missense	probably damaging	0.99
Director	UTSW	8	96,491,690 (GRCm39)	missense	probably benign	0.15
kowloon	UTSW	8	96,515,286 (GRCm39)	missense	probably damaging	1.00
Quorum	UTSW	8	96,452,746 (GRCm39)	missense	probably damaging	1.00
tugboat	UTSW	8	96,500,246 (GRCm39)	missense	probably damaging	0.99
Xiao	UTSW	8	96,457,048 (GRCm39)	missense	probably damaging	1.00
BB001:Cnot1	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
BB003:Cnot1	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
BB011:Cnot1	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
BB013:Cnot1	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
R0008:Cnot1	UTSW	8	96,487,969 (GRCm39)	missense	probably damaging	1.00
R0008:Cnot1	UTSW	8	96,487,969 (GRCm39)	missense	probably damaging	1.00
R0091:Cnot1	UTSW	8	96,489,772 (GRCm39)	missense	probably damaging	1.00
R0335:Cnot1	UTSW	8	96,498,628 (GRCm39)	missense	probably benign	0.02
R0409:Cnot1	UTSW	8	96,475,483 (GRCm39)	missense	probably damaging	0.96
R0445:Cnot1	UTSW	8	96,486,836 (GRCm39)	missense	probably damaging	1.00
R1517:Cnot1	UTSW	8	96,469,841 (GRCm39)	missense	probably benign	0.38
R1640:Cnot1	UTSW	8	96,496,460 (GRCm39)	missense	probably damaging	0.98
R1737:Cnot1	UTSW	8	96,474,904 (GRCm39)	missense	probably damaging	0.98
R1755:Cnot1	UTSW	8	96,451,205 (GRCm39)	missense	probably damaging	1.00
R1901:Cnot1	UTSW	8	96,469,749 (GRCm39)	missense	possibly damaging	0.50
R1902:Cnot1	UTSW	8	96,469,749 (GRCm39)	missense	possibly damaging	0.50
R1903:Cnot1	UTSW	8	96,469,749 (GRCm39)	missense	possibly damaging	0.50
R1988:Cnot1	UTSW	8	96,468,572 (GRCm39)	missense	possibly damaging	0.89
R2051:Cnot1	UTSW	8	96,451,221 (GRCm39)	missense	possibly damaging	0.47
R2054:Cnot1	UTSW	8	96,466,469 (GRCm39)	missense	possibly damaging	0.55
R2072:Cnot1	UTSW	8	96,466,461 (GRCm39)	missense	possibly damaging	0.89
R2074:Cnot1	UTSW	8	96,466,461 (GRCm39)	missense	possibly damaging	0.89
R2075:Cnot1	UTSW	8	96,466,461 (GRCm39)	missense	possibly damaging	0.89
R2093:Cnot1	UTSW	8	96,501,986 (GRCm39)	missense	probably damaging	1.00
R2116:Cnot1	UTSW	8	96,452,781 (GRCm39)	missense	probably damaging	1.00
R2191:Cnot1	UTSW	8	96,488,054 (GRCm39)	missense	probably damaging	0.98
R2238:Cnot1	UTSW	8	96,496,149 (GRCm39)	missense	probably benign	0.04
R2239:Cnot1	UTSW	8	96,496,149 (GRCm39)	missense	probably benign	0.04
R2251:Cnot1	UTSW	8	96,489,814 (GRCm39)	missense	probably benign	0.00
R2252:Cnot1	UTSW	8	96,489,814 (GRCm39)	missense	probably benign	0.00
R2253:Cnot1	UTSW	8	96,489,814 (GRCm39)	missense	probably benign	0.00
R2315:Cnot1	UTSW	8	96,475,690 (GRCm39)	missense	probably damaging	1.00
R2431:Cnot1	UTSW	8	96,501,280 (GRCm39)	missense	probably damaging	1.00
R2988:Cnot1	UTSW	8	96,470,906 (GRCm39)	missense	possibly damaging	0.80
R2989:Cnot1	UTSW	8	96,470,906 (GRCm39)	missense	possibly damaging	0.80
R3108:Cnot1	UTSW	8	96,462,377 (GRCm39)	missense	probably damaging	0.99
R3109:Cnot1	UTSW	8	96,462,377 (GRCm39)	missense	probably damaging	0.99
R3114:Cnot1	UTSW	8	96,470,906 (GRCm39)	missense	possibly damaging	0.80
R3115:Cnot1	UTSW	8	96,470,906 (GRCm39)	missense	possibly damaging	0.80
R3153:Cnot1	UTSW	8	96,470,906 (GRCm39)	missense	possibly damaging	0.80
R3154:Cnot1	UTSW	8	96,470,906 (GRCm39)	missense	possibly damaging	0.80
R4112:Cnot1	UTSW	8	96,500,246 (GRCm39)	missense	probably damaging	0.99
R4359:Cnot1	UTSW	8	96,466,476 (GRCm39)	missense	probably damaging	1.00
R4382:Cnot1	UTSW	8	96,496,407 (GRCm39)	missense	probably damaging	0.97
R4747:Cnot1	UTSW	8	96,501,310 (GRCm39)	missense	probably benign	0.27
R4910:Cnot1	UTSW	8	96,459,859 (GRCm39)	missense	probably benign	0.43
R4913:Cnot1	UTSW	8	96,489,695 (GRCm39)	missense	possibly damaging	0.63
R4971:Cnot1	UTSW	8	96,448,254 (GRCm39)	missense	probably damaging	1.00
R5056:Cnot1	UTSW	8	96,467,636 (GRCm39)	missense	probably damaging	1.00
R5092:Cnot1	UTSW	8	96,479,396 (GRCm39)	missense	possibly damaging	0.91
R5101:Cnot1	UTSW	8	96,486,815 (GRCm39)	missense	possibly damaging	0.90
R5498:Cnot1	UTSW	8	96,483,983 (GRCm39)	missense	possibly damaging	0.92
R5719:Cnot1	UTSW	8	96,470,924 (GRCm39)	missense	possibly damaging	0.92
R5850:Cnot1	UTSW	8	96,460,775 (GRCm39)	nonsense	probably null
R5956:Cnot1	UTSW	8	96,481,606 (GRCm39)	critical splice donor site	probably null
R5981:Cnot1	UTSW	8	96,515,293 (GRCm39)	missense	probably damaging	1.00
R6093:Cnot1	UTSW	8	96,475,522 (GRCm39)	missense	probably benign	0.03
R6108:Cnot1	UTSW	8	96,457,048 (GRCm39)	missense	probably damaging	1.00
R6261:Cnot1	UTSW	8	96,468,549 (GRCm39)	missense	probably benign	0.00
R6632:Cnot1	UTSW	8	96,499,895 (GRCm39)	intron	probably benign
R6882:Cnot1	UTSW	8	96,447,054 (GRCm39)	missense	possibly damaging	0.85
R6966:Cnot1	UTSW	8	96,451,160 (GRCm39)	missense	probably damaging	1.00
R6985:Cnot1	UTSW	8	96,460,757 (GRCm39)	missense	probably benign	0.13
R7210:Cnot1	UTSW	8	96,515,286 (GRCm39)	missense	probably damaging	1.00
R7410:Cnot1	UTSW	8	96,459,787 (GRCm39)	missense	possibly damaging	0.77
R7623:Cnot1	UTSW	8	96,454,276 (GRCm39)	missense	probably damaging	1.00
R7624:Cnot1	UTSW	8	96,478,447 (GRCm39)	missense	probably damaging	1.00
R7695:Cnot1	UTSW	8	96,497,260 (GRCm39)	missense	probably benign	0.03
R7703:Cnot1	UTSW	8	96,486,726 (GRCm39)	critical splice donor site	probably null
R7771:Cnot1	UTSW	8	96,491,753 (GRCm39)	missense	probably damaging	0.99
R7800:Cnot1	UTSW	8	96,491,690 (GRCm39)	missense	probably benign	0.15
R7809:Cnot1	UTSW	8	96,478,406 (GRCm39)	missense	probably damaging	1.00
R7857:Cnot1	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
R7914:Cnot1	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
R7924:Cnot1	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
R7926:Cnot1	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
R7981:Cnot1	UTSW	8	96,489,797 (GRCm39)	missense	probably damaging	1.00
R8004:Cnot1	UTSW	8	96,479,380 (GRCm39)	missense	probably benign	0.03
R8061:Cnot1	UTSW	8	96,491,655 (GRCm39)	missense	possibly damaging	0.95
R8185:Cnot1	UTSW	8	96,487,979 (GRCm39)	missense	probably damaging	1.00
R8269:Cnot1	UTSW	8	96,478,389 (GRCm39)	missense	probably damaging	1.00
R8306:Cnot1	UTSW	8	96,473,649 (GRCm39)	missense	probably benign	0.05
R8322:Cnot1	UTSW	8	96,496,472 (GRCm39)	missense	probably benign	0.00
R8427:Cnot1	UTSW	8	96,460,952 (GRCm39)	missense	probably benign	0.01
R8723:Cnot1	UTSW	8	96,462,907 (GRCm39)	missense	probably benign	0.00
R8934:Cnot1	UTSW	8	96,491,695 (GRCm39)	missense	probably benign	0.04
R9025:Cnot1	UTSW	8	96,475,660 (GRCm39)	missense	probably benign
R9179:Cnot1	UTSW	8	96,500,054 (GRCm39)	missense	probably benign	0.16
R9280:Cnot1	UTSW	8	96,497,227 (GRCm39)	missense	probably benign	0.15
R9285:Cnot1	UTSW	8	96,452,746 (GRCm39)	missense	probably damaging	1.00
R9299:Cnot1	UTSW	8	96,468,448 (GRCm39)	missense	probably damaging	1.00
R9337:Cnot1	UTSW	8	96,468,448 (GRCm39)	missense	probably damaging	1.00
R9480:Cnot1	UTSW	8	96,497,338 (GRCm39)	missense	possibly damaging	0.94
R9548:Cnot1	UTSW	8	96,482,854 (GRCm39)	missense	probably benign	0.02
R9601:Cnot1	UTSW	8	96,482,835 (GRCm39)	missense	probably benign	0.02
R9629:Cnot1	UTSW	8	96,455,874 (GRCm39)	missense	probably damaging	0.98
R9752:Cnot1	UTSW	8	96,488,019 (GRCm39)	missense	probably damaging	1.00
R9764:Cnot1	UTSW	8	96,496,209 (GRCm39)	missense	probably benign	0.00
R9789:Cnot1	UTSW	8	96,455,772 (GRCm39)	missense	probably damaging	1.00
X0050:Cnot1	UTSW	8	96,469,726 (GRCm39)	splice site	probably null
Z1176:Cnot1	UTSW	8	96,474,905 (GRCm39)	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- GGTCACCCAACAAAGCCTTCAGATG -3'
(R):5'- GCAGAGTGAATTTCAGCAACTTCCG -3'

Sequencing Primer
(F):5'- AGCCTTCAGATGCAGTCAAG -3'
(R):5'- GCAATACATTCCACATCTTGAGACC -3'

Posted On

2014-04-13