Incidental Mutation 'R1505:Robo4'
ID169120
Institutional Source Beutler Lab
Gene Symbol Robo4
Ensembl Gene ENSMUSG00000032125
Gene Nameroundabout guidance receptor 4
Synonyms1200012D01Rik, Magic roundabout
MMRRC Submission 040868-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.334) question?
Stock #R1505 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location37401897-37415115 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 37403227 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 170 (G170D)
Ref Sequence ENSEMBL: ENSMUSP00000110698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102895] [ENSMUST00000115046] [ENSMUST00000115048] [ENSMUST00000156972] [ENSMUST00000214185]
Predicted Effect probably damaging
Transcript: ENSMUST00000102895
AA Change: G170D

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099959
Gene: ENSMUSG00000032125
AA Change: G170D

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 488 494 N/A INTRINSIC
low complexity region 544 562 N/A INTRINSIC
low complexity region 720 733 N/A INTRINSIC
low complexity region 748 762 N/A INTRINSIC
low complexity region 775 799 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
low complexity region 871 880 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115046
AA Change: G170D

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110698
Gene: ENSMUSG00000032125
AA Change: G170D

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 484 500 N/A INTRINSIC
low complexity region 540 546 N/A INTRINSIC
low complexity region 596 614 N/A INTRINSIC
low complexity region 747 756 N/A INTRINSIC
low complexity region 779 792 N/A INTRINSIC
low complexity region 807 821 N/A INTRINSIC
low complexity region 834 858 N/A INTRINSIC
low complexity region 914 925 N/A INTRINSIC
low complexity region 930 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115048
AA Change: G59D

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000110700
Gene: ENSMUSG00000032125
AA Change: G59D

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 488 494 N/A INTRINSIC
low complexity region 544 562 N/A INTRINSIC
low complexity region 695 704 N/A INTRINSIC
low complexity region 727 740 N/A INTRINSIC
low complexity region 755 769 N/A INTRINSIC
low complexity region 782 806 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 878 887 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000156972
AA Change: G170D

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000214185
AA Change: G170D

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.5%
  • 20x: 86.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter/null allele display enhanced VEGF-induced endothelial migration, tube formation and vascular permeability, and show increased pathologic angiogenesis and vascular leak in models of oxygen-induced retinopathy and choroidal neovascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T A 5: 104,951,565 R444W probably damaging Het
Adnp A G 2: 168,183,741 S545P possibly damaging Het
Ankrd17 T C 5: 90,300,026 R219G possibly damaging Het
Ap2m1 C G 16: 20,542,697 P372A probably benign Het
Calml3 T A 13: 3,804,071 T45S probably benign Het
Casp8 A G 1: 58,828,922 E174G probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap221 A C 1: 119,953,628 L368R probably benign Het
Chd9 A G 8: 91,006,495 probably null Het
Cnot1 A T 8: 95,728,667 I2035N probably damaging Het
Cyp2c67 T C 19: 39,648,964 R23G probably benign Het
Dnah10 A C 5: 124,754,239 H777P possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam162b G A 10: 51,587,202 A123V probably damaging Het
Golgb1 T A 16: 36,919,643 N2781K possibly damaging Het
Hs2st1 C A 3: 144,434,561 R333L probably benign Het
Kmt2e A G 5: 23,500,535 H1319R probably null Het
Necab1 A T 4: 14,960,047 M300K probably benign Het
Ntrk3 T A 7: 78,460,524 I321F probably damaging Het
Olfr228 A T 2: 86,483,213 H176Q possibly damaging Het
Olfr484 A G 7: 108,124,993 V90A probably benign Het
Olfr860 A T 9: 19,845,788 M277K probably benign Het
Olfr965 A G 9: 39,719,478 N84D probably damaging Het
Osbpl6 T C 2: 76,579,242 S483P probably damaging Het
Pcdhb17 A C 18: 37,486,822 N555T probably damaging Het
Pdgfc G A 3: 81,209,236 R299H possibly damaging Het
Ptpn7 A T 1: 135,134,564 T83S probably benign Het
Rapgef5 T C 12: 117,688,619 V79A possibly damaging Het
Rexo5 T A 7: 119,799,603 C54* probably null Het
Riok3 A G 18: 12,152,878 K418R probably benign Het
Rpl8 A G 15: 76,904,410 D33G possibly damaging Het
Rspo2 T C 15: 43,075,843 T184A probably damaging Het
Ryr2 A T 13: 11,554,592 M4942K possibly damaging Het
Sel1l T C 12: 91,813,962 Y585C probably damaging Het
Slc25a11 G T 11: 70,646,824 D13E probably benign Het
Slc5a6 G T 5: 31,037,111 H584N probably benign Het
Snrpf A G 10: 93,583,519 V69A possibly damaging Het
Sorbs3 T A 14: 70,190,802 K475* probably null Het
Speg G A 1: 75,375,542 V35I probably benign Het
Tlk2 T G 11: 105,260,295 V468G probably damaging Het
Trim6 T A 7: 104,232,564 W341R probably damaging Het
Ttll5 T A 12: 85,879,410 I326N probably damaging Het
Vipas39 T C 12: 87,246,160 Y318C probably damaging Het
Vmn1r185 T A 7: 26,611,478 I201F probably damaging Het
Vwce A G 19: 10,664,244 H778R probably benign Het
Zbtb14 C G 17: 69,387,764 I152M probably benign Het
Other mutations in Robo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Robo4 APN 9 37411104 missense probably damaging 1.00
IGL00392:Robo4 APN 9 37408229 missense probably damaging 1.00
IGL00491:Robo4 APN 9 37405935 missense possibly damaging 0.52
IGL00792:Robo4 APN 9 37408211 missense probably damaging 1.00
IGL01062:Robo4 APN 9 37406000 missense probably benign 0.08
IGL01287:Robo4 APN 9 37413040 missense possibly damaging 0.96
IGL02289:Robo4 APN 9 37408200 missense probably damaging 1.00
IGL02486:Robo4 APN 9 37408374 missense probably damaging 1.00
IGL02851:Robo4 APN 9 37413382 missense probably damaging 0.96
IGL02898:Robo4 APN 9 37408176 missense probably damaging 0.99
IGL02965:Robo4 APN 9 37410469 missense possibly damaging 0.82
IGL03071:Robo4 APN 9 37404284 splice site probably benign
IGL03102:Robo4 APN 9 37404185 missense probably damaging 1.00
H8562:Robo4 UTSW 9 37405810 intron probably benign
R0056:Robo4 UTSW 9 37404477 missense probably benign 0.03
R0068:Robo4 UTSW 9 37404477 missense probably benign 0.03
R0233:Robo4 UTSW 9 37402681 missense probably damaging 1.00
R0233:Robo4 UTSW 9 37402681 missense probably damaging 1.00
R0416:Robo4 UTSW 9 37404766 splice site probably benign
R1005:Robo4 UTSW 9 37408251 missense probably damaging 1.00
R1174:Robo4 UTSW 9 37413052 missense probably damaging 1.00
R1183:Robo4 UTSW 9 37408052 missense probably damaging 1.00
R1254:Robo4 UTSW 9 37410840 critical splice donor site probably null
R1398:Robo4 UTSW 9 37408076 critical splice donor site probably null
R1701:Robo4 UTSW 9 37403443 missense probably benign 0.44
R1834:Robo4 UTSW 9 37413059 missense probably benign 0.09
R1899:Robo4 UTSW 9 37404070 splice site probably benign
R2203:Robo4 UTSW 9 37411490 frame shift probably null
R2204:Robo4 UTSW 9 37411490 frame shift probably null
R2351:Robo4 UTSW 9 37411660 missense probably benign 0.01
R2448:Robo4 UTSW 9 37402662 missense possibly damaging 0.96
R2847:Robo4 UTSW 9 37404476 nonsense probably null
R2851:Robo4 UTSW 9 37411490 frame shift probably null
R2852:Robo4 UTSW 9 37411490 frame shift probably null
R2877:Robo4 UTSW 9 37411490 frame shift probably null
R3123:Robo4 UTSW 9 37411490 frame shift probably null
R3124:Robo4 UTSW 9 37411490 frame shift probably null
R3125:Robo4 UTSW 9 37411490 frame shift probably null
R3805:Robo4 UTSW 9 37404438 missense possibly damaging 0.73
R3806:Robo4 UTSW 9 37404438 missense possibly damaging 0.73
R3892:Robo4 UTSW 9 37411490 frame shift probably null
R3905:Robo4 UTSW 9 37403505 nonsense probably null
R3938:Robo4 UTSW 9 37402017 start gained probably benign
R4261:Robo4 UTSW 9 37405581 missense probably benign 0.04
R4434:Robo4 UTSW 9 37411490 frame shift probably null
R4435:Robo4 UTSW 9 37411490 frame shift probably null
R4561:Robo4 UTSW 9 37411490 frame shift probably null
R4562:Robo4 UTSW 9 37411490 frame shift probably null
R4568:Robo4 UTSW 9 37404822 missense possibly damaging 0.59
R4695:Robo4 UTSW 9 37403199 missense probably damaging 1.00
R4921:Robo4 UTSW 9 37402560 missense probably benign
R5000:Robo4 UTSW 9 37408368 missense probably benign 0.02
R5056:Robo4 UTSW 9 37404806 missense probably benign 0.00
R5125:Robo4 UTSW 9 37407960 missense probably damaging 1.00
R5178:Robo4 UTSW 9 37407960 missense probably damaging 1.00
R5278:Robo4 UTSW 9 37411490 frame shift probably null
R5279:Robo4 UTSW 9 37411490 frame shift probably null
R5285:Robo4 UTSW 9 37411490 frame shift probably null
R5347:Robo4 UTSW 9 37411490 frame shift probably null
R5348:Robo4 UTSW 9 37411490 frame shift probably null
R5361:Robo4 UTSW 9 37413378 missense probably benign 0.01
R5403:Robo4 UTSW 9 37411490 frame shift probably null
R5404:Robo4 UTSW 9 37411490 frame shift probably null
R5488:Robo4 UTSW 9 37411490 frame shift probably null
R5489:Robo4 UTSW 9 37411490 frame shift probably null
R5490:Robo4 UTSW 9 37411490 frame shift probably null
R5494:Robo4 UTSW 9 37411490 frame shift probably null
R5629:Robo4 UTSW 9 37408362 missense probably damaging 1.00
R5736:Robo4 UTSW 9 37404797 missense possibly damaging 0.63
R5796:Robo4 UTSW 9 37411674 missense probably benign 0.00
R5987:Robo4 UTSW 9 37411400 missense probably damaging 1.00
R6178:Robo4 UTSW 9 37405630 nonsense probably null
R6189:Robo4 UTSW 9 37403533 missense probably benign 0.35
R6365:Robo4 UTSW 9 37410712 missense probably benign 0.34
R6528:Robo4 UTSW 9 37404368 missense possibly damaging 0.92
R6887:Robo4 UTSW 9 37402067 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ACATTACCTTTTGCCGGATGGGAC -3'
(R):5'- TTGCTCAATGTGCCCAGGACAG -3'

Sequencing Primer
(F):5'- ATGCTTGTGTCCAGGGAAATAC -3'
(R):5'- CCCAGGACAGGATGATGTATG -3'
Posted On2014-04-13