Incidental Mutation 'R1505:Sel1l'
ID169131
Institutional Source Beutler Lab
Gene Symbol Sel1l
Ensembl Gene ENSMUSG00000020964
Gene Namesel-1 suppressor of lin-12-like (C. elegans)
SynonymsSel1h
MMRRC Submission 040868-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1505 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location91806043-91849157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91813962 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 585 (Y585C)
Ref Sequence ENSEMBL: ENSMUSP00000129384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021347] [ENSMUST00000167466] [ENSMUST00000178462]
Predicted Effect probably damaging
Transcript: ENSMUST00000021347
AA Change: Y635C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021347
Gene: ENSMUSG00000020964
AA Change: Y635C

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
FN2 116 164 1.24e-24 SMART
SEL1 179 214 2.48e-1 SMART
SEL1 215 250 7.5e1 SMART
SEL1 251 286 1.86e-5 SMART
SEL1 287 322 1.16e-1 SMART
SEL1 369 405 7.93e-9 SMART
SEL1 406 442 8.05e-10 SMART
SEL1 443 478 2.48e-10 SMART
SEL1 479 514 1.91e-11 SMART
SEL1 515 550 9.04e-4 SMART
Pfam:Sel1 585 622 3.4e-1 PFAM
SEL1 623 658 4.42e-7 SMART
SEL1 660 695 2.28e-9 SMART
low complexity region 766 790 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165282
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166691
Predicted Effect probably damaging
Transcript: ENSMUST00000167466
AA Change: Y585C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129384
Gene: ENSMUSG00000020964
AA Change: Y585C

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SEL1 129 164 2.48e-1 SMART
SEL1 165 200 7.5e1 SMART
SEL1 201 236 1.86e-5 SMART
SEL1 237 272 1.16e-1 SMART
SEL1 319 355 7.93e-9 SMART
SEL1 356 392 8.05e-10 SMART
SEL1 393 428 2.48e-10 SMART
SEL1 429 464 1.91e-11 SMART
SEL1 465 500 9.04e-4 SMART
Pfam:Sel1 534 572 1.5e-1 PFAM
SEL1 573 608 4.42e-7 SMART
SEL1 610 645 2.28e-9 SMART
low complexity region 716 740 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171465
Predicted Effect probably damaging
Transcript: ENSMUST00000178462
AA Change: Y585C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136087
Gene: ENSMUSG00000020964
AA Change: Y585C

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SEL1 129 164 2.48e-1 SMART
SEL1 165 200 7.5e1 SMART
SEL1 201 236 1.86e-5 SMART
SEL1 237 272 1.16e-1 SMART
SEL1 319 355 7.93e-9 SMART
SEL1 356 392 8.05e-10 SMART
SEL1 393 428 2.48e-10 SMART
SEL1 429 464 1.91e-11 SMART
SEL1 465 500 9.04e-4 SMART
Pfam:Sel1 535 572 3.2e-1 PFAM
SEL1 573 608 4.42e-7 SMART
SEL1 610 645 2.28e-9 SMART
low complexity region 716 740 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.5%
  • 20x: 86.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a protein complex required for the retrotranslocation or dislocation of misfolded proteins from the endoplasmic reticulum lumen to the cytosol, where they are degraded by the proteasome in a ubiquitin-dependent manner. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit prenatal lethality with impaired exocrine and endocrine pancreatic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T A 5: 104,951,565 R444W probably damaging Het
Adnp A G 2: 168,183,741 S545P possibly damaging Het
Ankrd17 T C 5: 90,300,026 R219G possibly damaging Het
Ap2m1 C G 16: 20,542,697 P372A probably benign Het
Calml3 T A 13: 3,804,071 T45S probably benign Het
Casp8 A G 1: 58,828,922 E174G probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap221 A C 1: 119,953,628 L368R probably benign Het
Chd9 A G 8: 91,006,495 probably null Het
Cnot1 A T 8: 95,728,667 I2035N probably damaging Het
Cyp2c67 T C 19: 39,648,964 R23G probably benign Het
Dnah10 A C 5: 124,754,239 H777P possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam162b G A 10: 51,587,202 A123V probably damaging Het
Golgb1 T A 16: 36,919,643 N2781K possibly damaging Het
Hs2st1 C A 3: 144,434,561 R333L probably benign Het
Kmt2e A G 5: 23,500,535 H1319R probably null Het
Necab1 A T 4: 14,960,047 M300K probably benign Het
Ntrk3 T A 7: 78,460,524 I321F probably damaging Het
Olfr228 A T 2: 86,483,213 H176Q possibly damaging Het
Olfr484 A G 7: 108,124,993 V90A probably benign Het
Olfr860 A T 9: 19,845,788 M277K probably benign Het
Olfr965 A G 9: 39,719,478 N84D probably damaging Het
Osbpl6 T C 2: 76,579,242 S483P probably damaging Het
Pcdhb17 A C 18: 37,486,822 N555T probably damaging Het
Pdgfc G A 3: 81,209,236 R299H possibly damaging Het
Ptpn7 A T 1: 135,134,564 T83S probably benign Het
Rapgef5 T C 12: 117,688,619 V79A possibly damaging Het
Rexo5 T A 7: 119,799,603 C54* probably null Het
Riok3 A G 18: 12,152,878 K418R probably benign Het
Robo4 G A 9: 37,403,227 G170D probably damaging Het
Rpl8 A G 15: 76,904,410 D33G possibly damaging Het
Rspo2 T C 15: 43,075,843 T184A probably damaging Het
Ryr2 A T 13: 11,554,592 M4942K possibly damaging Het
Slc25a11 G T 11: 70,646,824 D13E probably benign Het
Slc5a6 G T 5: 31,037,111 H584N probably benign Het
Snrpf A G 10: 93,583,519 V69A possibly damaging Het
Sorbs3 T A 14: 70,190,802 K475* probably null Het
Speg G A 1: 75,375,542 V35I probably benign Het
Tlk2 T G 11: 105,260,295 V468G probably damaging Het
Trim6 T A 7: 104,232,564 W341R probably damaging Het
Ttll5 T A 12: 85,879,410 I326N probably damaging Het
Vipas39 T C 12: 87,246,160 Y318C probably damaging Het
Vmn1r185 T A 7: 26,611,478 I201F probably damaging Het
Vwce A G 19: 10,664,244 H778R probably benign Het
Zbtb14 C G 17: 69,387,764 I152M probably benign Het
Other mutations in Sel1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Sel1l APN 12 91814613 splice site probably benign
IGL01082:Sel1l APN 12 91811908 missense probably benign 0.41
IGL01402:Sel1l APN 12 91841833 missense possibly damaging 0.55
IGL01610:Sel1l APN 12 91817290 missense probably damaging 1.00
IGL01690:Sel1l APN 12 91843259 missense probably benign
IGL01803:Sel1l APN 12 91830730 missense probably benign 0.37
IGL01939:Sel1l APN 12 91816247 missense probably damaging 1.00
IGL02275:Sel1l APN 12 91815015 missense probably damaging 1.00
IGL02279:Sel1l APN 12 91814997 missense probably damaging 1.00
IGL02407:Sel1l APN 12 91843268 splice site probably benign
IGL02934:Sel1l APN 12 91809936 nonsense probably null
R0533:Sel1l UTSW 12 91820094 missense probably damaging 1.00
R0565:Sel1l UTSW 12 91811889 missense probably benign 0.16
R0565:Sel1l UTSW 12 91813945 missense possibly damaging 0.95
R0973:Sel1l UTSW 12 91824860 missense probably damaging 1.00
R1378:Sel1l UTSW 12 91833097 intron probably null
R1530:Sel1l UTSW 12 91826684 missense probably damaging 0.96
R2001:Sel1l UTSW 12 91826550 nonsense probably null
R3418:Sel1l UTSW 12 91810002 missense probably damaging 1.00
R3419:Sel1l UTSW 12 91810002 missense probably damaging 1.00
R4601:Sel1l UTSW 12 91833053 critical splice donor site probably null
R4776:Sel1l UTSW 12 91813893 missense probably damaging 1.00
R4839:Sel1l UTSW 12 91833158 missense probably benign 0.00
R4860:Sel1l UTSW 12 91831602 missense probably damaging 1.00
R4860:Sel1l UTSW 12 91831602 missense probably damaging 1.00
R4869:Sel1l UTSW 12 91814054 intron probably benign
R5261:Sel1l UTSW 12 91824884 missense possibly damaging 0.92
R5692:Sel1l UTSW 12 91811878 missense probably benign 0.02
R5744:Sel1l UTSW 12 91809980 missense possibly damaging 0.95
R5830:Sel1l UTSW 12 91833171 missense probably damaging 1.00
R6799:Sel1l UTSW 12 91814968 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGAATTCCAGAGGCACTGCTCTCC -3'
(R):5'- GTGAAGCAGCCCTGTCTTCTCTATG -3'

Sequencing Primer
(F):5'- GTGCATGTAGCCCAGGTTAA -3'
(R):5'- CTGTAACCTGCTTTCTGAGAAGAG -3'
Posted On2014-04-13