Incidental Mutation 'R1505:Zbtb14'
ID169140
Institutional Source Beutler Lab
Gene Symbol Zbtb14
Ensembl Gene ENSMUSG00000049672
Gene Namezinc finger and BTB domain containing 14
SynonymsZfp161, b2b1982Clo, ZF5
MMRRC Submission 040868-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.651) question?
Stock #R1505 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location69383050-69390750 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 69387764 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 152 (I152M)
Ref Sequence ENSEMBL: ENSMUSP00000108296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062369] [ENSMUST00000112674] [ENSMUST00000112676]
Predicted Effect probably benign
Transcript: ENSMUST00000062369
AA Change: I152M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000054897
Gene: ENSMUSG00000049672
AA Change: I152M

DomainStartEndE-ValueType
BTB 36 132 8.8e-26 SMART
low complexity region 154 171 N/A INTRINSIC
ZnF_C2H2 277 299 7.26e-3 SMART
ZnF_C2H2 305 327 3.95e-4 SMART
ZnF_C2H2 333 355 9.88e-5 SMART
ZnF_C2H2 361 383 2.2e-2 SMART
ZnF_C2H2 389 412 2.02e-1 SMART
low complexity region 428 444 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112674
AA Change: I152M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108294
Gene: ENSMUSG00000049672
AA Change: I152M

DomainStartEndE-ValueType
BTB 36 132 8.8e-26 SMART
low complexity region 154 171 N/A INTRINSIC
ZnF_C2H2 277 299 7.26e-3 SMART
ZnF_C2H2 305 327 3.95e-4 SMART
ZnF_C2H2 333 355 9.88e-5 SMART
ZnF_C2H2 361 383 2.2e-2 SMART
ZnF_C2H2 389 412 2.02e-1 SMART
low complexity region 428 444 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112676
AA Change: I152M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108296
Gene: ENSMUSG00000049672
AA Change: I152M

DomainStartEndE-ValueType
BTB 36 132 8.8e-26 SMART
low complexity region 154 171 N/A INTRINSIC
ZnF_C2H2 277 299 7.26e-3 SMART
ZnF_C2H2 305 327 3.95e-4 SMART
ZnF_C2H2 333 355 9.88e-5 SMART
ZnF_C2H2 361 383 2.2e-2 SMART
ZnF_C2H2 389 412 2.02e-1 SMART
low complexity region 428 444 N/A INTRINSIC
Meta Mutation Damage Score 0.1044 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.5%
  • 20x: 86.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation show exencephaly, cardiac defects including valve abnormalities, double outlet right ventricle, perimembranous ventricular septal defect, and atrioventricular septal defect, and renal anomalies such as duplex kidney, hydronephrosis, and kidney cysts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T A 5: 104,951,565 R444W probably damaging Het
Adnp A G 2: 168,183,741 S545P possibly damaging Het
Ankrd17 T C 5: 90,300,026 R219G possibly damaging Het
Ap2m1 C G 16: 20,542,697 P372A probably benign Het
Calml3 T A 13: 3,804,071 T45S probably benign Het
Casp8 A G 1: 58,828,922 E174G probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap221 A C 1: 119,953,628 L368R probably benign Het
Chd9 A G 8: 91,006,495 probably null Het
Cnot1 A T 8: 95,728,667 I2035N probably damaging Het
Cyp2c67 T C 19: 39,648,964 R23G probably benign Het
Dnah10 A C 5: 124,754,239 H777P possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam162b G A 10: 51,587,202 A123V probably damaging Het
Golgb1 T A 16: 36,919,643 N2781K possibly damaging Het
Hs2st1 C A 3: 144,434,561 R333L probably benign Het
Kmt2e A G 5: 23,500,535 H1319R probably null Het
Necab1 A T 4: 14,960,047 M300K probably benign Het
Ntrk3 T A 7: 78,460,524 I321F probably damaging Het
Olfr228 A T 2: 86,483,213 H176Q possibly damaging Het
Olfr484 A G 7: 108,124,993 V90A probably benign Het
Olfr860 A T 9: 19,845,788 M277K probably benign Het
Olfr965 A G 9: 39,719,478 N84D probably damaging Het
Osbpl6 T C 2: 76,579,242 S483P probably damaging Het
Pcdhb17 A C 18: 37,486,822 N555T probably damaging Het
Pdgfc G A 3: 81,209,236 R299H possibly damaging Het
Ptpn7 A T 1: 135,134,564 T83S probably benign Het
Rapgef5 T C 12: 117,688,619 V79A possibly damaging Het
Rexo5 T A 7: 119,799,603 C54* probably null Het
Riok3 A G 18: 12,152,878 K418R probably benign Het
Robo4 G A 9: 37,403,227 G170D probably damaging Het
Rpl8 A G 15: 76,904,410 D33G possibly damaging Het
Rspo2 T C 15: 43,075,843 T184A probably damaging Het
Ryr2 A T 13: 11,554,592 M4942K possibly damaging Het
Sel1l T C 12: 91,813,962 Y585C probably damaging Het
Slc25a11 G T 11: 70,646,824 D13E probably benign Het
Slc5a6 G T 5: 31,037,111 H584N probably benign Het
Snrpf A G 10: 93,583,519 V69A possibly damaging Het
Sorbs3 T A 14: 70,190,802 K475* probably null Het
Speg G A 1: 75,375,542 V35I probably benign Het
Tlk2 T G 11: 105,260,295 V468G probably damaging Het
Trim6 T A 7: 104,232,564 W341R probably damaging Het
Ttll5 T A 12: 85,879,410 I326N probably damaging Het
Vipas39 T C 12: 87,246,160 Y318C probably damaging Het
Vmn1r185 T A 7: 26,611,478 I201F probably damaging Het
Vwce A G 19: 10,664,244 H778R probably benign Het
Other mutations in Zbtb14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Zbtb14 APN 17 69388189 missense probably benign 0.04
IGL01623:Zbtb14 APN 17 69388189 missense probably benign 0.04
IGL02477:Zbtb14 APN 17 69387695 missense probably benign 0.00
R0736:Zbtb14 UTSW 17 69387802 missense possibly damaging 0.66
R0811:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R0812:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R0829:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R0866:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R0946:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R0947:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R1052:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R1053:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R1056:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R1076:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R1187:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R1374:Zbtb14 UTSW 17 69387580 missense probably damaging 1.00
R1471:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R1507:Zbtb14 UTSW 17 69387764 missense probably benign 0.00
R1508:Zbtb14 UTSW 17 69387764 missense probably benign 0.00
R1509:Zbtb14 UTSW 17 69387764 missense probably benign 0.00
R1514:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R1680:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R1691:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R1712:Zbtb14 UTSW 17 69387580 missense probably damaging 1.00
R1907:Zbtb14 UTSW 17 69387390 missense possibly damaging 0.91
R1981:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R2916:Zbtb14 UTSW 17 69388219 missense probably damaging 1.00
R2918:Zbtb14 UTSW 17 69388219 missense probably damaging 1.00
R4589:Zbtb14 UTSW 17 69388470 missense probably damaging 1.00
R4622:Zbtb14 UTSW 17 69388347 missense possibly damaging 0.80
R4812:Zbtb14 UTSW 17 69387582 missense probably damaging 1.00
R6246:Zbtb14 UTSW 17 69387483 missense possibly damaging 0.46
R6889:Zbtb14 UTSW 17 69387679 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGATGTAAAGTTCCGAGCCCACC -3'
(R):5'- ACTTCCTGGCCGTAACAGTTCAC -3'

Sequencing Primer
(F):5'- CAGCTCGTCCGTCATAGAGATAG -3'
(R):5'- GCCGTAACAGTTCACTTTCCG -3'
Posted On2014-04-13