Incidental Mutation 'R1500:Olfr1193'
ID169156
Institutional Source Beutler Lab
Gene Symbol Olfr1193
Ensembl Gene ENSMUSG00000060827
Gene Nameolfactory receptor 1193
SynonymsGA_x6K02T2Q125-50154044-50154826, GA_x6K02T2Q125-50158288-50158818, Olfr1194-ps1, MOR226-1, MOR230-9
MMRRC Submission 039551-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R1500 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88675628-88681143 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88677875 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 7 (S7T)
Ref Sequence ENSEMBL: ENSMUSP00000080399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081697] [ENSMUST00000099818] [ENSMUST00000213545] [ENSMUST00000213893] [ENSMUST00000216767]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081697
AA Change: S7T

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000080399
Gene: ENSMUSG00000060827
AA Change: S7T

DomainStartEndE-ValueType
Pfam:7tm_4 36 310 7.5e-51 PFAM
Pfam:7tm_1 46 292 7.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099818
SMART Domains Protein: ENSMUSP00000097406
Gene: ENSMUSG00000075121

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.5e-47 PFAM
Pfam:7TM_GPCR_Srsx 32 300 1.6e-5 PFAM
Pfam:7tm_1 39 285 5.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213545
Predicted Effect probably benign
Transcript: ENSMUST00000213893
Predicted Effect probably benign
Transcript: ENSMUST00000216767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217271
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.1%
Validation Efficiency 95% (81/85)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik C A 11: 78,284,132 Q1698K possibly damaging Het
A230050P20Rik AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA 9: 20,873,717 probably benign Het
Abcg1 A G 17: 31,111,279 D518G probably benign Het
Acaca T A 11: 84,293,984 D96E probably benign Het
Actbl2 G A 13: 111,255,320 R63Q probably damaging Het
Adamts6 T A 13: 104,312,881 H266Q probably damaging Het
Aff4 T C 11: 53,372,378 V75A probably benign Het
Ank2 A G 3: 126,932,982 S888P probably benign Het
Ano7 T C 1: 93,397,328 F534S probably damaging Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Bcam T A 7: 19,758,964 D484V possibly damaging Het
Ccdc88a T C 11: 29,482,713 Y1240H probably benign Het
Cfh T C 1: 140,100,876 Y500C probably damaging Het
Chd1l G A 3: 97,582,805 A478V probably benign Het
Dnah1 T C 14: 31,316,758 D122G probably benign Het
Dnah11 A T 12: 118,012,829 probably null Het
Dnah17 T C 11: 118,101,053 K1230E probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
E330020D12Rik A T 1: 153,408,379 noncoding transcript Het
Ece2 T C 16: 20,644,242 L639P probably damaging Het
Epha3 A T 16: 63,595,662 V658E probably benign Het
Erbb2 C T 11: 98,428,978 T632I probably damaging Het
Erc2 A G 14: 28,271,660 T883A probably damaging Het
Extl2 T C 3: 116,027,140 V198A probably benign Het
Fktn G T 4: 53,735,065 M234I probably benign Het
Ggt7 A G 2: 155,499,046 S400P probably benign Het
Gldc A C 19: 30,113,825 V790G possibly damaging Het
Gm14496 A C 2: 181,991,233 Q3P probably benign Het
H2-D1 G A 17: 35,263,588 E95K probably benign Het
Ikzf3 T C 11: 98,518,695 E14G probably benign Het
Jag1 A T 2: 137,115,638 N51K possibly damaging Het
Khdrbs3 A G 15: 68,928,786 D14G possibly damaging Het
Krt84 A G 15: 101,530,224 V276A probably damaging Het
Lamb1 T C 12: 31,298,949 I660T possibly damaging Het
Lcmt2 A T 2: 121,140,007 S198R probably benign Het
Lcn6 G A 2: 25,677,119 R44H probably benign Het
Lrfn5 A T 12: 61,839,741 H105L probably damaging Het
Lrit1 G A 14: 37,062,134 R473K probably benign Het
March1 A G 8: 66,468,390 T495A probably damaging Het
Marveld3 T G 8: 109,948,542 probably null Het
Mbd3 T C 10: 80,394,586 D160G possibly damaging Het
Mrc2 T G 11: 105,347,725 C1233G probably damaging Het
Ms4a13 T G 19: 11,183,861 T105P probably damaging Het
Mtbp T C 15: 55,617,555 Y306H probably damaging Het
Muc3a T C 5: 137,210,501 probably benign Het
Myo1g T A 11: 6,520,811 Y15F probably benign Het
Nae1 A T 8: 104,523,584 Y226N probably benign Het
Nlrp9a A G 7: 26,567,891 S715G probably benign Het
Olfr338 A T 2: 36,377,621 M282L probably benign Het
Olfr699 T C 7: 106,790,821 Y60C probably damaging Het
Olfr844 A T 9: 19,319,316 S267C probably damaging Het
Olfr972 G T 9: 39,873,411 M45I probably benign Het
Pex5l T C 3: 33,014,980 T123A probably damaging Het
Pip5kl1 A T 2: 32,576,679 N62I probably benign Het
Pkhd1l1 T C 15: 44,545,494 V2459A probably damaging Het
Prb1 T A 6: 132,207,476 Q398L unknown Het
Prkab2 T C 3: 97,663,947 L165S probably damaging Het
Prl3d2 C G 13: 27,121,706 probably benign Het
Ptdss1 G A 13: 66,995,408 G435D probably benign Het
Qrfpr A G 3: 36,182,580 L224P probably damaging Het
Rasl2-9 C T 7: 5,125,442 W163* probably null Het
Rgs5 A G 1: 169,690,414 probably null Het
Rnf19b T C 4: 129,078,961 L255P probably damaging Het
Rp9 A C 9: 22,457,455 N69K probably damaging Het
Sh3bp4 G T 1: 89,145,488 S686I probably damaging Het
Spp2 C A 1: 88,412,293 Q5K possibly damaging Het
Svep1 C T 4: 58,070,239 G2516R probably damaging Het
Syncrip A C 9: 88,479,896 S55R probably damaging Het
Tacc3 T C 5: 33,661,308 L29P probably damaging Het
Tex15 A G 8: 33,575,092 T1517A probably damaging Het
Tmem140 A G 6: 34,872,725 M59V probably benign Het
Ttn G T 2: 76,745,528 A25007E probably damaging Het
Ubr2 T C 17: 46,986,689 T253A possibly damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Usp38 A G 8: 80,995,770 L374P probably damaging Het
Vmn1r42 T A 6: 89,845,501 I29L probably benign Het
Vmn2r94 C T 17: 18,256,980 V390M probably benign Het
Vmp1 A G 11: 86,661,200 Y113H possibly damaging Het
Wdr20 T C 12: 110,794,030 M450T probably benign Het
Ylpm1 T C 12: 85,014,996 V557A unknown Het
Zpld1 T C 16: 55,233,572 N286D probably damaging Het
Other mutations in Olfr1193
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01939:Olfr1193 APN 2 88678733 missense probably damaging 1.00
R0322:Olfr1193 UTSW 2 88678667 missense probably damaging 0.98
R0711:Olfr1193 UTSW 2 88678674 missense probably damaging 1.00
R1610:Olfr1193 UTSW 2 88678574 nonsense probably null
R4380:Olfr1193 UTSW 2 88678271 missense possibly damaging 0.61
R4602:Olfr1193 UTSW 2 88677896 missense probably benign 0.08
R4602:Olfr1193 UTSW 2 88678179 missense probably benign
R4610:Olfr1193 UTSW 2 88677896 missense probably benign 0.08
R4610:Olfr1193 UTSW 2 88678179 missense probably benign
R4790:Olfr1193 UTSW 2 88678387 missense possibly damaging 0.73
R4803:Olfr1193 UTSW 2 88678022 missense probably benign 0.34
R5402:Olfr1193 UTSW 2 88678148 missense possibly damaging 0.74
R5736:Olfr1193 UTSW 2 88678641 missense probably benign 0.00
R6896:Olfr1193 UTSW 2 88677996 missense probably damaging 1.00
R6998:Olfr1193 UTSW 2 88678508 missense probably benign 0.23
R7038:Olfr1193 UTSW 2 88678741 missense probably damaging 1.00
X0022:Olfr1193 UTSW 2 88678320 missense probably benign 0.08
Z1088:Olfr1193 UTSW 2 88678664 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCCAGAACAGGCAGTATGAAGC -3'
(R):5'- TGCTGTGACTGAGGAGTAGCAAATG -3'

Sequencing Primer
(F):5'- GGAAAGTGCTCTTCAAATATCTCACG -3'
(R):5'- CTGAGGAGTAGCAAATGTCCAC -3'
Posted On2014-04-13