Incidental Mutation 'R1500:Gm14496'
ID169160
Institutional Source Beutler Lab
Gene Symbol Gm14496
Ensembl Gene ENSMUSG00000098505
Gene Namepredicted gene 14496
Synonyms
MMRRC Submission 039551-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1500 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location181991226-182001766 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 181991233 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 3 (Q3P)
Ref Sequence ENSEMBL: ENSMUSP00000071670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071760]
Predicted Effect probably benign
Transcript: ENSMUST00000071760
AA Change: Q3P

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000071670
Gene: ENSMUSG00000098505
AA Change: Q3P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 76 456 1.3e-30 PFAM
Pfam:NCD3G 508 562 1.9e-18 PFAM
Pfam:7tm_3 595 830 7.9e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000089788
SMART Domains Protein: ENSMUSP00000087221
Gene: ENSMUSG00000053277

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 76 425 2.8e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184507
Meta Mutation Damage Score 0.12 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.1%
Validation Efficiency 95% (81/85)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik C A 11: 78,284,132 Q1698K possibly damaging Het
A230050P20Rik AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA 9: 20,873,717 probably benign Het
Abcg1 A G 17: 31,111,279 D518G probably benign Het
Acaca T A 11: 84,293,984 D96E probably benign Het
Actbl2 G A 13: 111,255,320 R63Q probably damaging Het
Adamts6 T A 13: 104,312,881 H266Q probably damaging Het
Aff4 T C 11: 53,372,378 V75A probably benign Het
Ank2 A G 3: 126,932,982 S888P probably benign Het
Ano7 T C 1: 93,397,328 F534S probably damaging Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Bcam T A 7: 19,758,964 D484V possibly damaging Het
Ccdc88a T C 11: 29,482,713 Y1240H probably benign Het
Cfh T C 1: 140,100,876 Y500C probably damaging Het
Chd1l G A 3: 97,582,805 A478V probably benign Het
Dnah1 T C 14: 31,316,758 D122G probably benign Het
Dnah11 A T 12: 118,012,829 probably null Het
Dnah17 T C 11: 118,101,053 K1230E probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
E330020D12Rik A T 1: 153,408,379 noncoding transcript Het
Ece2 T C 16: 20,644,242 L639P probably damaging Het
Epha3 A T 16: 63,595,662 V658E probably benign Het
Erbb2 C T 11: 98,428,978 T632I probably damaging Het
Erc2 A G 14: 28,271,660 T883A probably damaging Het
Extl2 T C 3: 116,027,140 V198A probably benign Het
Fktn G T 4: 53,735,065 M234I probably benign Het
Ggt7 A G 2: 155,499,046 S400P probably benign Het
Gldc A C 19: 30,113,825 V790G possibly damaging Het
H2-D1 G A 17: 35,263,588 E95K probably benign Het
Ikzf3 T C 11: 98,518,695 E14G probably benign Het
Jag1 A T 2: 137,115,638 N51K possibly damaging Het
Khdrbs3 A G 15: 68,928,786 D14G possibly damaging Het
Krt84 A G 15: 101,530,224 V276A probably damaging Het
Lamb1 T C 12: 31,298,949 I660T possibly damaging Het
Lcmt2 A T 2: 121,140,007 S198R probably benign Het
Lcn6 G A 2: 25,677,119 R44H probably benign Het
Lrfn5 A T 12: 61,839,741 H105L probably damaging Het
Lrit1 G A 14: 37,062,134 R473K probably benign Het
March1 A G 8: 66,468,390 T495A probably damaging Het
Marveld3 T G 8: 109,948,542 probably null Het
Mbd3 T C 10: 80,394,586 D160G possibly damaging Het
Mrc2 T G 11: 105,347,725 C1233G probably damaging Het
Ms4a13 T G 19: 11,183,861 T105P probably damaging Het
Mtbp T C 15: 55,617,555 Y306H probably damaging Het
Muc3a T C 5: 137,210,501 probably benign Het
Myo1g T A 11: 6,520,811 Y15F probably benign Het
Nae1 A T 8: 104,523,584 Y226N probably benign Het
Nlrp9a A G 7: 26,567,891 S715G probably benign Het
Olfr1193 T A 2: 88,677,875 S7T possibly damaging Het
Olfr338 A T 2: 36,377,621 M282L probably benign Het
Olfr699 T C 7: 106,790,821 Y60C probably damaging Het
Olfr844 A T 9: 19,319,316 S267C probably damaging Het
Olfr972 G T 9: 39,873,411 M45I probably benign Het
Pex5l T C 3: 33,014,980 T123A probably damaging Het
Pip5kl1 A T 2: 32,576,679 N62I probably benign Het
Pkhd1l1 T C 15: 44,545,494 V2459A probably damaging Het
Prb1 T A 6: 132,207,476 Q398L unknown Het
Prkab2 T C 3: 97,663,947 L165S probably damaging Het
Prl3d2 C G 13: 27,121,706 probably benign Het
Ptdss1 G A 13: 66,995,408 G435D probably benign Het
Qrfpr A G 3: 36,182,580 L224P probably damaging Het
Rasl2-9 C T 7: 5,125,442 W163* probably null Het
Rgs5 A G 1: 169,690,414 probably null Het
Rnf19b T C 4: 129,078,961 L255P probably damaging Het
Rp9 A C 9: 22,457,455 N69K probably damaging Het
Sh3bp4 G T 1: 89,145,488 S686I probably damaging Het
Spp2 C A 1: 88,412,293 Q5K possibly damaging Het
Svep1 C T 4: 58,070,239 G2516R probably damaging Het
Syncrip A C 9: 88,479,896 S55R probably damaging Het
Tacc3 T C 5: 33,661,308 L29P probably damaging Het
Tex15 A G 8: 33,575,092 T1517A probably damaging Het
Tmem140 A G 6: 34,872,725 M59V probably benign Het
Ttn G T 2: 76,745,528 A25007E probably damaging Het
Ubr2 T C 17: 46,986,689 T253A possibly damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Usp38 A G 8: 80,995,770 L374P probably damaging Het
Vmn1r42 T A 6: 89,845,501 I29L probably benign Het
Vmn2r94 C T 17: 18,256,980 V390M probably benign Het
Vmp1 A G 11: 86,661,200 Y113H possibly damaging Het
Wdr20 T C 12: 110,794,030 M450T probably benign Het
Ylpm1 T C 12: 85,014,996 V557A unknown Het
Zpld1 T C 16: 55,233,572 N286D probably damaging Het
Other mutations in Gm14496
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01144:Gm14496 APN 2 181995021 missense probably damaging 1.00
IGL01300:Gm14496 APN 2 182000960 missense probably damaging 1.00
IGL01328:Gm14496 APN 2 181995880 missense probably damaging 1.00
IGL01526:Gm14496 APN 2 181995665 missense probably benign 0.12
IGL01576:Gm14496 APN 2 181991371 missense possibly damaging 0.92
IGL01775:Gm14496 APN 2 182000332 missense probably benign 0.00
IGL02020:Gm14496 APN 2 181996089 missense possibly damaging 0.95
IGL02150:Gm14496 APN 2 181991347 missense probably damaging 0.99
IGL02170:Gm14496 APN 2 181996351 missense probably damaging 1.00
IGL02262:Gm14496 APN 2 181996012 missense probably damaging 1.00
IGL02398:Gm14496 APN 2 181996170 missense probably benign 0.09
IGL02414:Gm14496 APN 2 181991405 missense probably benign 0.03
IGL02541:Gm14496 APN 2 182000393 missense probably benign 0.29
IGL02741:Gm14496 APN 2 181991343 missense probably benign
IGL02933:Gm14496 APN 2 182000463 missense probably benign 0.15
IGL03214:Gm14496 APN 2 182000536 missense probably damaging 1.00
FR4342:Gm14496 UTSW 2 181995906 missense probably benign 0.01
R0158:Gm14496 UTSW 2 181997413 missense probably benign 0.07
R0271:Gm14496 UTSW 2 181995954 missense probably benign 0.44
R0611:Gm14496 UTSW 2 181995111 missense probably benign 0.00
R0833:Gm14496 UTSW 2 181996266 missense probably damaging 0.99
R0834:Gm14496 UTSW 2 181995687 missense probably benign 0.00
R0906:Gm14496 UTSW 2 182000515 missense probably damaging 0.98
R1298:Gm14496 UTSW 2 181996092 missense probably benign 0.39
R1585:Gm14496 UTSW 2 181996209 missense possibly damaging 0.79
R1610:Gm14496 UTSW 2 181996179 missense probably benign 0.01
R1627:Gm14496 UTSW 2 181998778 missense probably damaging 1.00
R1635:Gm14496 UTSW 2 182001044 missense possibly damaging 0.88
R1663:Gm14496 UTSW 2 181997437 missense probably benign 0.03
R1792:Gm14496 UTSW 2 181996153 missense probably benign 0.00
R1888:Gm14496 UTSW 2 182000196 nonsense probably null
R1888:Gm14496 UTSW 2 182000196 nonsense probably null
R1922:Gm14496 UTSW 2 182001004 missense probably benign 0.22
R2081:Gm14496 UTSW 2 182000479 missense probably damaging 1.00
R2102:Gm14496 UTSW 2 181991334 missense possibly damaging 0.88
R2176:Gm14496 UTSW 2 181991337 missense probably benign
R4154:Gm14496 UTSW 2 181995079 missense probably benign 0.01
R4789:Gm14496 UTSW 2 181995784 missense possibly damaging 0.85
R4873:Gm14496 UTSW 2 181997433 missense probably damaging 0.99
R4875:Gm14496 UTSW 2 181997433 missense probably damaging 0.99
R5020:Gm14496 UTSW 2 181991359 missense possibly damaging 0.67
R5354:Gm14496 UTSW 2 182000809 missense probably damaging 1.00
R5361:Gm14496 UTSW 2 182000354 missense probably benign 0.07
R5457:Gm14496 UTSW 2 181997608 missense probably damaging 0.96
R5589:Gm14496 UTSW 2 181995881 nonsense probably null
R5655:Gm14496 UTSW 2 181996182 missense probably benign 0.06
R6007:Gm14496 UTSW 2 181997530 missense probably benign 0.37
R6123:Gm14496 UTSW 2 181991227 start codon destroyed probably null 1.00
R6159:Gm14496 UTSW 2 181996257 missense probably benign 0.01
R6168:Gm14496 UTSW 2 182000957 missense probably damaging 1.00
R6454:Gm14496 UTSW 2 181996222 missense probably damaging 0.97
R6502:Gm14496 UTSW 2 182000593 missense probably benign 0.01
R6649:Gm14496 UTSW 2 181997476 missense possibly damaging 0.83
R6996:Gm14496 UTSW 2 181996204 missense probably damaging 1.00
R7043:Gm14496 UTSW 2 182000327 missense possibly damaging 0.70
R7317:Gm14496 UTSW 2 181995820 missense possibly damaging 0.56
R7354:Gm14496 UTSW 2 182000686 missense probably damaging 1.00
R7565:Gm14496 UTSW 2 181991257 missense possibly damaging 0.84
R7565:Gm14496 UTSW 2 182000837 missense probably damaging 0.99
X0058:Gm14496 UTSW 2 181995986 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCTGAGGCCAGAATTTTCCCTATG -3'
(R):5'- CAGTGATGCAGTCTCCTCTTATTGAGC -3'

Sequencing Primer
(F):5'- AGGCCAGAATTTTCCCTATGTATCC -3'
(R):5'- CCAGTCTTGTGAACTGGAGC -3'
Posted On2014-04-13