Incidental Mutation 'R1500:Erc2'
ID169214
Institutional Source Beutler Lab
Gene Symbol Erc2
Ensembl Gene ENSMUSG00000040640
Gene NameELKS/RAB6-interacting/CAST family member 2
SynonymsELKS2alpha, D14Ertd171e
MMRRC Submission 039551-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1500 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location27622428-28478537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28271660 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 883 (T883A)
Ref Sequence ENSEMBL: ENSMUSP00000147886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090302] [ENSMUST00000210135] [ENSMUST00000210924] [ENSMUST00000211145]
Predicted Effect probably damaging
Transcript: ENSMUST00000090302
AA Change: T879A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000087773
Gene: ENSMUSG00000040640
AA Change: T879A

DomainStartEndE-ValueType
low complexity region 14 45 N/A INTRINSIC
low complexity region 121 133 N/A INTRINSIC
Pfam:Cast 150 907 N/A PFAM
low complexity region 916 928 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209800
Predicted Effect probably damaging
Transcript: ENSMUST00000210135
AA Change: T903A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000210924
AA Change: T549A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000211145
AA Change: T883A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.194 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.1%
Validation Efficiency 95% (81/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Rab3-interacting molecule (RIM)-binding protein family. Members of this protein family form part of the cytomatrix at the active zone (CAZ) complex and function as regulators of neurotransmitter release. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for targeted disruptions of this gene are viable and fertile. However, homozygotes for one allele display abnormal CNS synaptic transmission. Homozygotes for a second allele display retinal abnormalities and impaired vision. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik C A 11: 78,284,132 Q1698K possibly damaging Het
A230050P20Rik AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA 9: 20,873,717 probably benign Het
Abcg1 A G 17: 31,111,279 D518G probably benign Het
Acaca T A 11: 84,293,984 D96E probably benign Het
Actbl2 G A 13: 111,255,320 R63Q probably damaging Het
Adamts6 T A 13: 104,312,881 H266Q probably damaging Het
Aff4 T C 11: 53,372,378 V75A probably benign Het
Ank2 A G 3: 126,932,982 S888P probably benign Het
Ano7 T C 1: 93,397,328 F534S probably damaging Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Bcam T A 7: 19,758,964 D484V possibly damaging Het
Ccdc88a T C 11: 29,482,713 Y1240H probably benign Het
Cfh T C 1: 140,100,876 Y500C probably damaging Het
Chd1l G A 3: 97,582,805 A478V probably benign Het
Dnah1 T C 14: 31,316,758 D122G probably benign Het
Dnah11 A T 12: 118,012,829 probably null Het
Dnah17 T C 11: 118,101,053 K1230E probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
E330020D12Rik A T 1: 153,408,379 noncoding transcript Het
Ece2 T C 16: 20,644,242 L639P probably damaging Het
Epha3 A T 16: 63,595,662 V658E probably benign Het
Erbb2 C T 11: 98,428,978 T632I probably damaging Het
Extl2 T C 3: 116,027,140 V198A probably benign Het
Fktn G T 4: 53,735,065 M234I probably benign Het
Ggt7 A G 2: 155,499,046 S400P probably benign Het
Gldc A C 19: 30,113,825 V790G possibly damaging Het
Gm14496 A C 2: 181,991,233 Q3P probably benign Het
H2-D1 G A 17: 35,263,588 E95K probably benign Het
Ikzf3 T C 11: 98,518,695 E14G probably benign Het
Jag1 A T 2: 137,115,638 N51K possibly damaging Het
Khdrbs3 A G 15: 68,928,786 D14G possibly damaging Het
Krt84 A G 15: 101,530,224 V276A probably damaging Het
Lamb1 T C 12: 31,298,949 I660T possibly damaging Het
Lcmt2 A T 2: 121,140,007 S198R probably benign Het
Lcn6 G A 2: 25,677,119 R44H probably benign Het
Lrfn5 A T 12: 61,839,741 H105L probably damaging Het
Lrit1 G A 14: 37,062,134 R473K probably benign Het
March1 A G 8: 66,468,390 T495A probably damaging Het
Marveld3 T G 8: 109,948,542 probably null Het
Mbd3 T C 10: 80,394,586 D160G possibly damaging Het
Mrc2 T G 11: 105,347,725 C1233G probably damaging Het
Ms4a13 T G 19: 11,183,861 T105P probably damaging Het
Mtbp T C 15: 55,617,555 Y306H probably damaging Het
Muc3a T C 5: 137,210,501 probably benign Het
Myo1g T A 11: 6,520,811 Y15F probably benign Het
Nae1 A T 8: 104,523,584 Y226N probably benign Het
Nlrp9a A G 7: 26,567,891 S715G probably benign Het
Olfr1193 T A 2: 88,677,875 S7T possibly damaging Het
Olfr338 A T 2: 36,377,621 M282L probably benign Het
Olfr699 T C 7: 106,790,821 Y60C probably damaging Het
Olfr844 A T 9: 19,319,316 S267C probably damaging Het
Olfr972 G T 9: 39,873,411 M45I probably benign Het
Pex5l T C 3: 33,014,980 T123A probably damaging Het
Pip5kl1 A T 2: 32,576,679 N62I probably benign Het
Pkhd1l1 T C 15: 44,545,494 V2459A probably damaging Het
Prb1 T A 6: 132,207,476 Q398L unknown Het
Prkab2 T C 3: 97,663,947 L165S probably damaging Het
Prl3d2 C G 13: 27,121,706 probably benign Het
Ptdss1 G A 13: 66,995,408 G435D probably benign Het
Qrfpr A G 3: 36,182,580 L224P probably damaging Het
Rasl2-9 C T 7: 5,125,442 W163* probably null Het
Rgs5 A G 1: 169,690,414 probably null Het
Rnf19b T C 4: 129,078,961 L255P probably damaging Het
Rp9 A C 9: 22,457,455 N69K probably damaging Het
Sh3bp4 G T 1: 89,145,488 S686I probably damaging Het
Spp2 C A 1: 88,412,293 Q5K possibly damaging Het
Svep1 C T 4: 58,070,239 G2516R probably damaging Het
Syncrip A C 9: 88,479,896 S55R probably damaging Het
Tacc3 T C 5: 33,661,308 L29P probably damaging Het
Tex15 A G 8: 33,575,092 T1517A probably damaging Het
Tmem140 A G 6: 34,872,725 M59V probably benign Het
Ttn G T 2: 76,745,528 A25007E probably damaging Het
Ubr2 T C 17: 46,986,689 T253A possibly damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Usp38 A G 8: 80,995,770 L374P probably damaging Het
Vmn1r42 T A 6: 89,845,501 I29L probably benign Het
Vmn2r94 C T 17: 18,256,980 V390M probably benign Het
Vmp1 A G 11: 86,661,200 Y113H possibly damaging Het
Wdr20 T C 12: 110,794,030 M450T probably benign Het
Ylpm1 T C 12: 85,014,996 V557A unknown Het
Zpld1 T C 16: 55,233,572 N286D probably damaging Het
Other mutations in Erc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Erc2 APN 14 28040521 missense probably damaging 0.98
IGL01862:Erc2 APN 14 28271569 splice site probably benign
IGL01906:Erc2 APN 14 28141306 missense probably damaging 0.99
IGL02177:Erc2 APN 14 27898623 missense probably benign 0.00
IGL02481:Erc2 APN 14 27653071 missense probably damaging 1.00
IGL02483:Erc2 APN 14 27653071 missense probably damaging 1.00
IGL02623:Erc2 APN 14 27776980 missense probably damaging 1.00
IGL03252:Erc2 APN 14 28475649 utr 3 prime probably benign
IGL03378:Erc2 APN 14 28011723 missense probably damaging 1.00
lobe UTSW 14 28317251 missense probably damaging 0.96
R0091:Erc2 UTSW 14 27776824 critical splice acceptor site probably null
R0309:Erc2 UTSW 14 28141225 missense probably damaging 0.98
R0357:Erc2 UTSW 14 27777022 missense probably damaging 0.99
R0378:Erc2 UTSW 14 28011694 missense probably damaging 1.00
R0550:Erc2 UTSW 14 28271651 missense possibly damaging 0.74
R0815:Erc2 UTSW 14 28025148 missense probably benign 0.04
R0863:Erc2 UTSW 14 28025148 missense probably benign 0.04
R1121:Erc2 UTSW 14 28475655 utr 3 prime probably benign
R1164:Erc2 UTSW 14 28302972 missense probably damaging 0.99
R1498:Erc2 UTSW 14 28302898 missense probably benign 0.27
R1555:Erc2 UTSW 14 28011665 missense probably damaging 0.99
R1894:Erc2 UTSW 14 28141228 missense probably damaging 0.99
R1950:Erc2 UTSW 14 27912900 missense probably damaging 0.99
R1991:Erc2 UTSW 14 28011636 missense probably benign 0.34
R2698:Erc2 UTSW 14 28271705 missense probably benign 0.06
R2847:Erc2 UTSW 14 28040488 missense probably damaging 0.97
R3015:Erc2 UTSW 14 28011775 critical splice donor site probably null
R3612:Erc2 UTSW 14 27777177 missense possibly damaging 0.69
R3759:Erc2 UTSW 14 28025163 missense possibly damaging 0.94
R3857:Erc2 UTSW 14 28475642 utr 3 prime probably benign
R3858:Erc2 UTSW 14 28475642 utr 3 prime probably benign
R3859:Erc2 UTSW 14 28475642 utr 3 prime probably benign
R4556:Erc2 UTSW 14 28302904 missense probably damaging 1.00
R4739:Erc2 UTSW 14 27776881 missense probably damaging 1.00
R4898:Erc2 UTSW 14 27653328 missense probably damaging 1.00
R5068:Erc2 UTSW 14 28302943 missense possibly damaging 0.63
R5113:Erc2 UTSW 14 27652872 missense probably benign 0.40
R5418:Erc2 UTSW 14 27966510 missense probably benign 0.14
R5741:Erc2 UTSW 14 28302869 splice site probably null
R5819:Erc2 UTSW 14 28141369 missense probably damaging 0.97
R5930:Erc2 UTSW 14 27776858 missense probably damaging 0.99
R6073:Erc2 UTSW 14 28011636 missense probably benign 0.00
R6150:Erc2 UTSW 14 28141291 missense probably damaging 0.97
R6182:Erc2 UTSW 14 28317253 missense probably damaging 0.99
R6188:Erc2 UTSW 14 28317251 missense probably damaging 0.96
R6267:Erc2 UTSW 14 28080155 missense probably damaging 1.00
R6296:Erc2 UTSW 14 28080155 missense probably damaging 1.00
R6730:Erc2 UTSW 14 27898567 missense possibly damaging 0.95
R6969:Erc2 UTSW 14 27898596 missense probably damaging 1.00
R7095:Erc2 UTSW 14 27898593 missense not run
Predicted Primers PCR Primer
(F):5'- AAACCCTCTCTCAGATGGCACAATG -3'
(R):5'- CATGGTATTTCAGCAACAGCGCAG -3'

Sequencing Primer
(F):5'- GAGTCTTAATGAGTCTGACCCAGC -3'
(R):5'- CAGGCTGTTTGGCTCCTAC -3'
Posted On2014-04-13