Incidental Mutation 'R1501:Pld5'
Institutional Source Beutler Lab
Gene Symbol Pld5
Ensembl Gene ENSMUSG00000055214
Gene Namephospholipase D family, member 5
MMRRC Submission 040867-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R1501 (G1)
Quality Score225
Status Not validated
Chromosomal Location175962306-176275312 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 175975521 bp
Amino Acid Change Phenylalanine to Leucine at position 393 (F393L)
Ref Sequence ENSEMBL: ENSMUSP00000069326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065967] [ENSMUST00000104983] [ENSMUST00000111167] [ENSMUST00000125404]
Predicted Effect probably benign
Transcript: ENSMUST00000065967
AA Change: F393L

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000069326
Gene: ENSMUSG00000055214
AA Change: F393L

transmembrane domain 68 90 N/A INTRINSIC
PLDc 215 242 3.62e-3 SMART
Pfam:PLDc_3 245 421 2e-101 PFAM
PLDc 434 460 6.11e0 SMART
low complexity region 511 521 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000104983
SMART Domains Protein: ENSMUSP00000100599
Gene: ENSMUSG00000078184

low complexity region 27 46 N/A INTRINSIC
RRM 74 147 8.44e-22 SMART
low complexity region 152 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111167
AA Change: F331L

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106797
Gene: ENSMUSG00000055214
AA Change: F331L

signal peptide 1 21 N/A INTRINSIC
PLDc 153 180 3.62e-3 SMART
PLDc 372 398 6.11e0 SMART
low complexity region 449 459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125404
SMART Domains Protein: ENSMUSP00000121428
Gene: ENSMUSG00000055214

transmembrane domain 69 91 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: No abnormal phenotype was observed in a high-throughput screen, nor in a pathology assessment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 A T 14: 78,513,347 S533R probably benign Het
Amph C T 13: 19,104,291 Q317* probably null Het
Bach2 A G 4: 32,562,279 T249A possibly damaging Het
Cacna2d3 A G 14: 28,981,180 C845R probably damaging Het
Calml4 A G 9: 62,871,340 K12E probably benign Het
Chrd C T 16: 20,737,533 R615W probably damaging Het
Chst15 T A 7: 132,269,069 K246* probably null Het
Cmtr2 G A 8: 110,221,603 D182N probably benign Het
Cyp2d9 C A 15: 82,454,324 C186* probably null Het
Cyp3a13 G T 5: 137,911,630 probably null Het
Dcaf17 A T 2: 71,081,988 I320F probably damaging Het
Ddx10 T C 9: 53,233,997 I227V possibly damaging Het
Dlc1 G T 8: 36,938,148 N162K probably benign Het
Dnhd1 G A 7: 105,668,463 R455H probably benign Het
Drg2 G T 11: 60,464,853 A306S probably benign Het
Dsg1a A T 18: 20,332,019 R422S probably damaging Het
Ehbp1l1 A G 19: 5,716,424 V353A probably damaging Het
Emilin2 T C 17: 71,310,761 S34G probably benign Het
Enpp2 C A 15: 54,839,514 W862L probably damaging Het
Exoc2 T C 13: 30,935,502 I139V probably benign Het
Fhad1 C T 4: 141,964,625 R400H probably benign Het
Fv1 C T 4: 147,870,138 T387M probably damaging Het
Gatad1 T A 5: 3,643,701 D156V probably damaging Het
Gm4744 A G 6: 40,950,433 probably benign Het
Gm4799 G A 10: 82,954,635 noncoding transcript Het
Hadha A G 5: 30,128,806 F405S probably benign Het
Ifit3 T C 19: 34,588,251 V399A probably benign Het
Il1rapl1 G T X: 87,304,863 Y150* probably null Het
Kirrel T C 3: 87,090,472 E248G probably benign Het
Krt72 C A 15: 101,778,334 K392N probably damaging Het
Loxhd1 G A 18: 77,356,832 G309D probably damaging Het
Mc3r T G 2: 172,249,380 I174S probably benign Het
Me3 A G 7: 89,633,065 D52G probably benign Het
Med12l T C 3: 59,260,835 probably null Het
Mgat5 G A 1: 127,397,641 probably null Het
Mgea5 T C 19: 45,778,640 D99G probably null Het
Mphosph10 A T 7: 64,389,504 F239L probably damaging Het
Mrps7 T C 11: 115,604,197 S13P probably benign Het
Nexn T C 3: 152,237,686 T527A possibly damaging Het
Nlrp1b G A 11: 71,156,059 H1156Y probably damaging Het
Nostrin A G 2: 69,158,785 E120G probably damaging Het
Nsun2 A G 13: 69,631,587 E624G probably damaging Het
Olfr1189 G A 2: 88,592,148 V115I possibly damaging Het
Olfr495 A C 7: 108,396,082 K321Q probably benign Het
Olfr503 G A 7: 108,544,575 V15I probably benign Het
Olfr730 A G 14: 50,187,082 I45T probably damaging Het
Phldb2 T C 16: 45,777,783 N802S probably damaging Het
Pik3c2g T C 6: 139,844,070 probably null Het
Pikfyve T A 1: 65,265,284 I1670N possibly damaging Het
Plekhg1 C A 10: 3,957,361 D759E probably benign Het
Plekhm1 A G 11: 103,387,062 S403P probably benign Het
Pop1 T C 15: 34,510,357 F432L probably benign Het
Ptpn13 T C 5: 103,516,364 I406T probably benign Het
Ptpn5 G T 7: 47,089,875 D185E probably benign Het
Rad50 G T 11: 53,688,151 Q527K possibly damaging Het
Scn7a A G 2: 66,700,163 F613L probably benign Het
Sec16a T A 2: 26,440,045 M653L probably benign Het
Sh3bp2 T C 5: 34,555,576 probably null Het
Slc22a3 G A 17: 12,507,104 T74I probably benign Het
Slc23a4 A G 6: 34,955,122 L272P probably damaging Het
Slc26a8 T C 17: 28,638,562 D869G possibly damaging Het
Slc5a11 T A 7: 123,260,508 V291E probably damaging Het
Slc6a19 C A 13: 73,684,048 A470S probably benign Het
Slfn8 A G 11: 83,003,180 S878P probably damaging Het
Smchd1 A G 17: 71,365,094 M1655T possibly damaging Het
Srgap2 A G 1: 131,292,699 L179P probably damaging Het
Tbx2 A G 11: 85,834,796 D191G probably damaging Het
Tenm3 A G 8: 48,343,316 Y485H probably damaging Het
Trim12c T A 7: 104,340,888 probably benign Het
Trpc6 A G 9: 8,610,169 T213A probably damaging Het
Upp1 T A 11: 9,134,708 probably null Het
Vmn1r46 A T 6: 89,976,216 I16L probably benign Het
Vmn2r75 A T 7: 86,165,642 D214E possibly damaging Het
Vmn2r95 T A 17: 18,439,856 Y177N probably damaging Het
Vmn2r99 T G 17: 19,362,259 I42S possibly damaging Het
Zeb1 A T 18: 5,761,399 K232N possibly damaging Het
Zfp280b T C 10: 76,039,769 I494T probably damaging Het
Zfp804a A G 2: 82,235,799 D38G probably damaging Het
Other mutations in Pld5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Pld5 APN 1 176140019 missense probably damaging 1.00
IGL00949:Pld5 APN 1 175975473 missense probably damaging 1.00
IGL01067:Pld5 APN 1 176274879 utr 5 prime probably benign
IGL02174:Pld5 APN 1 176274744 missense possibly damaging 0.86
IGL02380:Pld5 APN 1 176140044 missense probably damaging 0.97
IGL02879:Pld5 APN 1 175970591 missense probably damaging 1.00
R0087:Pld5 UTSW 1 175984459 missense probably damaging 0.98
R0135:Pld5 UTSW 1 175970589 missense probably damaging 1.00
R0144:Pld5 UTSW 1 175970541 missense probably benign 0.00
R0362:Pld5 UTSW 1 175975580 nonsense probably null
R0453:Pld5 UTSW 1 176089956 missense possibly damaging 0.75
R0454:Pld5 UTSW 1 176274729 missense probably benign 0.00
R0722:Pld5 UTSW 1 175975515 missense probably benign 0.34
R0751:Pld5 UTSW 1 176044896 missense probably damaging 0.98
R0785:Pld5 UTSW 1 175975452 splice site probably benign
R1184:Pld5 UTSW 1 176044896 missense probably damaging 0.98
R1644:Pld5 UTSW 1 175975626 missense possibly damaging 0.86
R2012:Pld5 UTSW 1 175964013 missense probably benign 0.27
R2426:Pld5 UTSW 1 175963976 missense probably benign
R3508:Pld5 UTSW 1 175994037 missense probably damaging 1.00
R3917:Pld5 UTSW 1 175963938 missense probably benign 0.00
R4207:Pld5 UTSW 1 175993875 missense probably damaging 1.00
R4373:Pld5 UTSW 1 176140017 missense probably damaging 1.00
R4828:Pld5 UTSW 1 176274867 missense probably benign 0.06
R4831:Pld5 UTSW 1 176274884 utr 5 prime probably benign
R5861:Pld5 UTSW 1 176090005 missense probably damaging 1.00
R6182:Pld5 UTSW 1 176044854 missense probably benign 0.35
R6191:Pld5 UTSW 1 175970534 missense probably benign 0.04
R6246:Pld5 UTSW 1 175963909 nonsense probably null
R6737:Pld5 UTSW 1 176090022 missense probably damaging 1.00
R7082:Pld5 UTSW 1 176089876 missense probably benign 0.21
X0004:Pld5 UTSW 1 176261522 critical splice acceptor site probably null
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ggagagaccctgccttaaaac -3'
Posted On2014-04-13