Incidental Mutation 'R1501:Rad50'
ID169284
Institutional Source Beutler Lab
Gene Symbol Rad50
Ensembl Gene ENSMUSG00000020380
Gene NameRAD50 double strand break repair protein
SynonymsRad50l, Mrell
MMRRC Submission 040867-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1501 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location53649519-53707319 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 53688151 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 527 (Q527K)
Ref Sequence ENSEMBL: ENSMUSP00000120869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020649] [ENSMUST00000124352] [ENSMUST00000128483]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020649
AA Change: Q527K

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000020649
Gene: ENSMUSG00000020380
AA Change: Q527K

DomainStartEndE-ValueType
Pfam:AAA_23 6 295 1.8e-31 PFAM
coiled coil region 397 534 N/A INTRINSIC
Pfam:Rad50_zn_hook 659 712 9.9e-16 PFAM
low complexity region 825 836 N/A INTRINSIC
low complexity region 919 929 N/A INTRINSIC
coiled coil region 1019 1075 N/A INTRINSIC
Pfam:SbcCD_C 1174 1251 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124352
SMART Domains Protein: ENSMUSP00000119618
Gene: ENSMUSG00000020380

DomainStartEndE-ValueType
Pfam:AAA_23 6 290 2.7e-24 PFAM
coiled coil region 397 469 N/A INTRINSIC
Pfam:Rad50_zn_hook 597 652 1.9e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000128483
AA Change: Q527K

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000120869
Gene: ENSMUSG00000020380
AA Change: Q527K

DomainStartEndE-ValueType
Pfam:AAA_23 6 295 6e-23 PFAM
coiled coil region 397 534 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152598
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to Saccharomyces cerevisiae Rad50, a protein involved in DNA double-strand break repair. This protein forms a complex with MRE11 and NBS1. The protein complex binds to DNA and displays numerous enzymatic activities that are required for nonhomologous joining of DNA ends. This protein, cooperating with its partners, is important for DNA double-strand break repair, cell cycle checkpoint activation, telomere maintenance, and meiotic recombination. Knockout studies of the mouse homolog suggest this gene is essential for cell growth and viability. Mutations in this gene are the cause of Nijmegen breakage syndrome-like disorder.[provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygotes for a targeted hypomorphic mutation exhibit growth defects, predisposition toward cancer, progressive loss of hematopoietic and spermatogenic stem cells, and lethality due to bone marrow depletion. A null mutation results in embryonic death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 A T 14: 78,513,347 S533R probably benign Het
Amph C T 13: 19,104,291 Q317* probably null Het
Bach2 A G 4: 32,562,279 T249A possibly damaging Het
Cacna2d3 A G 14: 28,981,180 C845R probably damaging Het
Calml4 A G 9: 62,871,340 K12E probably benign Het
Chrd C T 16: 20,737,533 R615W probably damaging Het
Chst15 T A 7: 132,269,069 K246* probably null Het
Cmtr2 G A 8: 110,221,603 D182N probably benign Het
Cyp2d9 C A 15: 82,454,324 C186* probably null Het
Cyp3a13 G T 5: 137,911,630 probably null Het
Dcaf17 A T 2: 71,081,988 I320F probably damaging Het
Ddx10 T C 9: 53,233,997 I227V possibly damaging Het
Dlc1 G T 8: 36,938,148 N162K probably benign Het
Dnhd1 G A 7: 105,668,463 R455H probably benign Het
Drg2 G T 11: 60,464,853 A306S probably benign Het
Dsg1a A T 18: 20,332,019 R422S probably damaging Het
Ehbp1l1 A G 19: 5,716,424 V353A probably damaging Het
Emilin2 T C 17: 71,310,761 S34G probably benign Het
Enpp2 C A 15: 54,839,514 W862L probably damaging Het
Exoc2 T C 13: 30,935,502 I139V probably benign Het
Fhad1 C T 4: 141,964,625 R400H probably benign Het
Fv1 C T 4: 147,870,138 T387M probably damaging Het
Gatad1 T A 5: 3,643,701 D156V probably damaging Het
Gm4744 A G 6: 40,950,433 probably benign Het
Gm4799 G A 10: 82,954,635 noncoding transcript Het
Hadha A G 5: 30,128,806 F405S probably benign Het
Ifit3 T C 19: 34,588,251 V399A probably benign Het
Il1rapl1 G T X: 87,304,863 Y150* probably null Het
Kirrel T C 3: 87,090,472 E248G probably benign Het
Krt72 C A 15: 101,778,334 K392N probably damaging Het
Loxhd1 G A 18: 77,356,832 G309D probably damaging Het
Mc3r T G 2: 172,249,380 I174S probably benign Het
Me3 A G 7: 89,633,065 D52G probably benign Het
Med12l T C 3: 59,260,835 probably null Het
Mgat5 G A 1: 127,397,641 probably null Het
Mgea5 T C 19: 45,778,640 D99G probably null Het
Mphosph10 A T 7: 64,389,504 F239L probably damaging Het
Mrps7 T C 11: 115,604,197 S13P probably benign Het
Nexn T C 3: 152,237,686 T527A possibly damaging Het
Nlrp1b G A 11: 71,156,059 H1156Y probably damaging Het
Nostrin A G 2: 69,158,785 E120G probably damaging Het
Nsun2 A G 13: 69,631,587 E624G probably damaging Het
Olfr1189 G A 2: 88,592,148 V115I possibly damaging Het
Olfr495 A C 7: 108,396,082 K321Q probably benign Het
Olfr503 G A 7: 108,544,575 V15I probably benign Het
Olfr730 A G 14: 50,187,082 I45T probably damaging Het
Phldb2 T C 16: 45,777,783 N802S probably damaging Het
Pik3c2g T C 6: 139,844,070 probably null Het
Pikfyve T A 1: 65,265,284 I1670N possibly damaging Het
Pld5 A G 1: 175,975,521 F393L probably benign Het
Plekhg1 C A 10: 3,957,361 D759E probably benign Het
Plekhm1 A G 11: 103,387,062 S403P probably benign Het
Pop1 T C 15: 34,510,357 F432L probably benign Het
Ptpn13 T C 5: 103,516,364 I406T probably benign Het
Ptpn5 G T 7: 47,089,875 D185E probably benign Het
Scn7a A G 2: 66,700,163 F613L probably benign Het
Sec16a T A 2: 26,440,045 M653L probably benign Het
Sh3bp2 T C 5: 34,555,576 probably null Het
Slc22a3 G A 17: 12,507,104 T74I probably benign Het
Slc23a4 A G 6: 34,955,122 L272P probably damaging Het
Slc26a8 T C 17: 28,638,562 D869G possibly damaging Het
Slc5a11 T A 7: 123,260,508 V291E probably damaging Het
Slc6a19 C A 13: 73,684,048 A470S probably benign Het
Slfn8 A G 11: 83,003,180 S878P probably damaging Het
Smchd1 A G 17: 71,365,094 M1655T possibly damaging Het
Srgap2 A G 1: 131,292,699 L179P probably damaging Het
Tbx2 A G 11: 85,834,796 D191G probably damaging Het
Tenm3 A G 8: 48,343,316 Y485H probably damaging Het
Trim12c T A 7: 104,340,888 probably benign Het
Trpc6 A G 9: 8,610,169 T213A probably damaging Het
Upp1 T A 11: 9,134,708 probably null Het
Vmn1r46 A T 6: 89,976,216 I16L probably benign Het
Vmn2r75 A T 7: 86,165,642 D214E possibly damaging Het
Vmn2r95 T A 17: 18,439,856 Y177N probably damaging Het
Vmn2r99 T G 17: 19,362,259 I42S possibly damaging Het
Zeb1 A T 18: 5,761,399 K232N possibly damaging Het
Zfp280b T C 10: 76,039,769 I494T probably damaging Het
Zfp804a A G 2: 82,235,799 D38G probably damaging Het
Other mutations in Rad50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Rad50 APN 11 53686311 intron probably benign
IGL00709:Rad50 APN 11 53669642 missense possibly damaging 0.49
IGL01080:Rad50 APN 11 53706068 missense probably damaging 1.00
IGL01357:Rad50 APN 11 53707021 missense probably damaging 1.00
IGL01979:Rad50 APN 11 53686178 nonsense probably null
IGL02481:Rad50 APN 11 53680049 missense probably benign 0.20
IGL02483:Rad50 APN 11 53680049 missense probably benign 0.20
IGL02673:Rad50 APN 11 53688240 missense probably benign 0.19
IGL02754:Rad50 APN 11 53702056 missense probably damaging 1.00
IGL03372:Rad50 APN 11 53695294 missense probably benign 0.20
PIT4131001:Rad50 UTSW 11 53694899 critical splice donor site probably null
R0035:Rad50 UTSW 11 53655027 splice site probably benign
R0035:Rad50 UTSW 11 53655027 splice site probably benign
R0270:Rad50 UTSW 11 53668025 missense probably damaging 1.00
R0373:Rad50 UTSW 11 53650519 missense probably damaging 1.00
R0567:Rad50 UTSW 11 53654956 missense probably damaging 1.00
R1132:Rad50 UTSW 11 53694961 missense possibly damaging 0.58
R1249:Rad50 UTSW 11 53692137 missense probably damaging 0.99
R1368:Rad50 UTSW 11 53683245 nonsense probably null
R1506:Rad50 UTSW 11 53679485 missense probably damaging 0.98
R1633:Rad50 UTSW 11 53692859 missense probably benign 0.00
R1663:Rad50 UTSW 11 53668223 missense probably benign 0.01
R1847:Rad50 UTSW 11 53702107 missense possibly damaging 0.68
R1933:Rad50 UTSW 11 53680061 missense probably benign 0.16
R2176:Rad50 UTSW 11 53698209 missense probably benign 0.00
R2519:Rad50 UTSW 11 53707185 start gained probably benign
R3027:Rad50 UTSW 11 53695381 missense probably benign 0.00
R3894:Rad50 UTSW 11 53678870 missense probably benign 0.01
R4181:Rad50 UTSW 11 53702005 missense probably benign 0.00
R4302:Rad50 UTSW 11 53702005 missense probably benign 0.00
R4836:Rad50 UTSW 11 53650653 missense probably damaging 1.00
R4934:Rad50 UTSW 11 53684275 missense probably benign 0.05
R5047:Rad50 UTSW 11 53674696 critical splice donor site probably null
R5201:Rad50 UTSW 11 53698820 critical splice donor site probably null
R5325:Rad50 UTSW 11 53692863 missense probably benign 0.16
R5368:Rad50 UTSW 11 53684246 missense probably benign 0.02
R5403:Rad50 UTSW 11 53695281 critical splice donor site probably null
R5421:Rad50 UTSW 11 53674946 missense probably benign 0.02
R6282:Rad50 UTSW 11 53669770 splice site probably null
R6468:Rad50 UTSW 11 53692144 missense possibly damaging 0.81
R6469:Rad50 UTSW 11 53684235 missense probably benign 0.08
R6528:Rad50 UTSW 11 53652282 missense probably damaging 1.00
R6704:Rad50 UTSW 11 53698918 missense probably damaging 1.00
R6886:Rad50 UTSW 11 53686184 missense probably benign 0.01
R7055:Rad50 UTSW 11 53688102 missense probably benign 0.02
R7268:Rad50 UTSW 11 53684275 missense probably benign 0.01
R7288:Rad50 UTSW 11 53654949 nonsense probably null
R7380:Rad50 UTSW 11 53695396 missense probably benign 0.00
R7467:Rad50 UTSW 11 53654908 missense probably damaging 1.00
R7533:Rad50 UTSW 11 53698919 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACATAGCTTTTCccaggtacaatggt -3'
(R):5'- TCATTACAGCAGAGTACAGTACCCTGAA -3'

Sequencing Primer
(F):5'- caggaagggcaacaggg -3'
(R):5'- CAGTACCCTGAATAAGATTTTTCCC -3'
Posted On2014-04-13