Incidental Mutation 'R1501:Plekhm1'
ID169290
Institutional Source Beutler Lab
Gene Symbol Plekhm1
Ensembl Gene ENSMUSG00000034247
Gene Namepleckstrin homology domain containing, family M (with RUN domain) member 1
SynonymsB2, D330036J23Rik, AP162
MMRRC Submission 040867-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1501 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location103364275-103412687 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103387062 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 403 (S403P)
Ref Sequence ENSEMBL: ENSMUSP00000047327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041272]
Predicted Effect probably benign
Transcript: ENSMUST00000041272
AA Change: S403P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000047327
Gene: ENSMUSG00000034247
AA Change: S403P

DomainStartEndE-ValueType
RUN 117 180 3.36e-20 SMART
low complexity region 246 273 N/A INTRINSIC
low complexity region 336 350 N/A INTRINSIC
low complexity region 361 373 N/A INTRINSIC
Blast:DUF4206 448 543 2e-11 BLAST
PH 552 644 2.16e-9 SMART
low complexity region 658 674 N/A INTRINSIC
PH 702 797 2.15e-4 SMART
DUF4206 864 1068 7.51e-103 SMART
C1 1005 1058 2.72e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184350
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is essential for bone resorption, and may play a critical role in vesicular transport in the osteoclast. Mutations in this gene are associated with autosomal recessive osteopetrosis type 6 (OPTB6). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased trabecular bone mass and decreased bone resorption capacity of osteoclasts caused by defects in the peripheral positioning and secretion of lysosomes. Mice homozygous for a gene trap insertion do not exhibit any detectable phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 A T 14: 78,513,347 S533R probably benign Het
Amph C T 13: 19,104,291 Q317* probably null Het
Bach2 A G 4: 32,562,279 T249A possibly damaging Het
Cacna2d3 A G 14: 28,981,180 C845R probably damaging Het
Calml4 A G 9: 62,871,340 K12E probably benign Het
Chrd C T 16: 20,737,533 R615W probably damaging Het
Chst15 T A 7: 132,269,069 K246* probably null Het
Cmtr2 G A 8: 110,221,603 D182N probably benign Het
Cyp2d9 C A 15: 82,454,324 C186* probably null Het
Cyp3a13 G T 5: 137,911,630 probably null Het
Dcaf17 A T 2: 71,081,988 I320F probably damaging Het
Ddx10 T C 9: 53,233,997 I227V possibly damaging Het
Dlc1 G T 8: 36,938,148 N162K probably benign Het
Dnhd1 G A 7: 105,668,463 R455H probably benign Het
Drg2 G T 11: 60,464,853 A306S probably benign Het
Dsg1a A T 18: 20,332,019 R422S probably damaging Het
Ehbp1l1 A G 19: 5,716,424 V353A probably damaging Het
Emilin2 T C 17: 71,310,761 S34G probably benign Het
Enpp2 C A 15: 54,839,514 W862L probably damaging Het
Exoc2 T C 13: 30,935,502 I139V probably benign Het
Fhad1 C T 4: 141,964,625 R400H probably benign Het
Fv1 C T 4: 147,870,138 T387M probably damaging Het
Gatad1 T A 5: 3,643,701 D156V probably damaging Het
Gm4744 A G 6: 40,950,433 probably benign Het
Gm4799 G A 10: 82,954,635 noncoding transcript Het
Hadha A G 5: 30,128,806 F405S probably benign Het
Ifit3 T C 19: 34,588,251 V399A probably benign Het
Il1rapl1 G T X: 87,304,863 Y150* probably null Het
Kirrel T C 3: 87,090,472 E248G probably benign Het
Krt72 C A 15: 101,778,334 K392N probably damaging Het
Loxhd1 G A 18: 77,356,832 G309D probably damaging Het
Mc3r T G 2: 172,249,380 I174S probably benign Het
Me3 A G 7: 89,633,065 D52G probably benign Het
Med12l T C 3: 59,260,835 probably null Het
Mgat5 G A 1: 127,397,641 probably null Het
Mgea5 T C 19: 45,778,640 D99G probably null Het
Mphosph10 A T 7: 64,389,504 F239L probably damaging Het
Mrps7 T C 11: 115,604,197 S13P probably benign Het
Nexn T C 3: 152,237,686 T527A possibly damaging Het
Nlrp1b G A 11: 71,156,059 H1156Y probably damaging Het
Nostrin A G 2: 69,158,785 E120G probably damaging Het
Nsun2 A G 13: 69,631,587 E624G probably damaging Het
Olfr1189 G A 2: 88,592,148 V115I possibly damaging Het
Olfr495 A C 7: 108,396,082 K321Q probably benign Het
Olfr503 G A 7: 108,544,575 V15I probably benign Het
Olfr730 A G 14: 50,187,082 I45T probably damaging Het
Phldb2 T C 16: 45,777,783 N802S probably damaging Het
Pik3c2g T C 6: 139,844,070 probably null Het
Pikfyve T A 1: 65,265,284 I1670N possibly damaging Het
Pld5 A G 1: 175,975,521 F393L probably benign Het
Plekhg1 C A 10: 3,957,361 D759E probably benign Het
Pop1 T C 15: 34,510,357 F432L probably benign Het
Ptpn13 T C 5: 103,516,364 I406T probably benign Het
Ptpn5 G T 7: 47,089,875 D185E probably benign Het
Rad50 G T 11: 53,688,151 Q527K possibly damaging Het
Scn7a A G 2: 66,700,163 F613L probably benign Het
Sec16a T A 2: 26,440,045 M653L probably benign Het
Sh3bp2 T C 5: 34,555,576 probably null Het
Slc22a3 G A 17: 12,507,104 T74I probably benign Het
Slc23a4 A G 6: 34,955,122 L272P probably damaging Het
Slc26a8 T C 17: 28,638,562 D869G possibly damaging Het
Slc5a11 T A 7: 123,260,508 V291E probably damaging Het
Slc6a19 C A 13: 73,684,048 A470S probably benign Het
Slfn8 A G 11: 83,003,180 S878P probably damaging Het
Smchd1 A G 17: 71,365,094 M1655T possibly damaging Het
Srgap2 A G 1: 131,292,699 L179P probably damaging Het
Tbx2 A G 11: 85,834,796 D191G probably damaging Het
Tenm3 A G 8: 48,343,316 Y485H probably damaging Het
Trim12c T A 7: 104,340,888 probably benign Het
Trpc6 A G 9: 8,610,169 T213A probably damaging Het
Upp1 T A 11: 9,134,708 probably null Het
Vmn1r46 A T 6: 89,976,216 I16L probably benign Het
Vmn2r75 A T 7: 86,165,642 D214E possibly damaging Het
Vmn2r95 T A 17: 18,439,856 Y177N probably damaging Het
Vmn2r99 T G 17: 19,362,259 I42S possibly damaging Het
Zeb1 A T 18: 5,761,399 K232N possibly damaging Het
Zfp280b T C 10: 76,039,769 I494T probably damaging Het
Zfp804a A G 2: 82,235,799 D38G probably damaging Het
Other mutations in Plekhm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Plekhm1 APN 11 103394783 missense possibly damaging 0.54
IGL01876:Plekhm1 APN 11 103376751 missense probably damaging 1.00
IGL02159:Plekhm1 APN 11 103380231 missense probably benign 0.04
IGL02404:Plekhm1 APN 11 103394998 missense probably benign 0.18
IGL02537:Plekhm1 APN 11 103397192 missense probably damaging 1.00
IGL02568:Plekhm1 APN 11 103395050 missense probably damaging 1.00
IGL02660:Plekhm1 APN 11 103374094 splice site probably benign
IGL03130:Plekhm1 APN 11 103377381 missense probably benign 0.17
IGL03208:Plekhm1 APN 11 103376770 missense probably benign 0.00
R0442:Plekhm1 UTSW 11 103397174 missense possibly damaging 0.45
R0491:Plekhm1 UTSW 11 103394776 missense probably benign 0.05
R0520:Plekhm1 UTSW 11 103394944 missense probably benign 0.17
R0964:Plekhm1 UTSW 11 103395082 nonsense probably null
R1189:Plekhm1 UTSW 11 103387062 missense probably benign 0.00
R1697:Plekhm1 UTSW 11 103376884 missense probably damaging 1.00
R1781:Plekhm1 UTSW 11 103394856 missense probably damaging 1.00
R1873:Plekhm1 UTSW 11 103373998 missense probably benign 0.01
R2087:Plekhm1 UTSW 11 103397025 critical splice donor site probably null
R2215:Plekhm1 UTSW 11 103376985 missense probably damaging 1.00
R2271:Plekhm1 UTSW 11 103387122 missense probably benign 0.00
R4256:Plekhm1 UTSW 11 103370934 missense probably damaging 0.98
R4393:Plekhm1 UTSW 11 103376965 missense possibly damaging 0.51
R4526:Plekhm1 UTSW 11 103395304 missense probably damaging 0.97
R5119:Plekhm1 UTSW 11 103387315 missense possibly damaging 0.62
R5975:Plekhm1 UTSW 11 103376691 missense possibly damaging 0.49
R6389:Plekhm1 UTSW 11 103366894 missense probably benign 0.21
R6454:Plekhm1 UTSW 11 103377382 missense probably damaging 1.00
R6755:Plekhm1 UTSW 11 103387243 missense possibly damaging 0.65
R6830:Plekhm1 UTSW 11 103376889 missense probably damaging 0.97
R7039:Plekhm1 UTSW 11 103395228 missense probably damaging 1.00
R7066:Plekhm1 UTSW 11 103370988 missense possibly damaging 0.47
R7149:Plekhm1 UTSW 11 103394916 missense probably damaging 0.98
X0058:Plekhm1 UTSW 11 103377366 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGTCACCAGATGGACAAACTTCAG -3'
(R):5'- AATTCTGCACCAAGCAGCGGAC -3'

Sequencing Primer
(F):5'- CAGATGGACAAACTTCAGCTTAG -3'
(R):5'- CCCATGTTCCAGACGCC -3'
Posted On2014-04-13