Incidental Mutation 'R1501:Krt72'
ID169303
Institutional Source Beutler Lab
Gene Symbol Krt72
Ensembl Gene ENSMUSG00000056605
Gene Namekeratin 72
SynonymsKrt72-ps, K6irs2
MMRRC Submission 040867-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R1501 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location101776172-101786460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 101778334 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 392 (K392N)
Ref Sequence ENSEMBL: ENSMUSP00000065922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071104]
Predicted Effect probably damaging
Transcript: ENSMUST00000071104
AA Change: K392N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065922
Gene: ENSMUSG00000056605
AA Change: K392N

DomainStartEndE-ValueType
Pfam:Keratin_2_head 59 130 3.1e-17 PFAM
Filament 133 446 6.9e-157 SMART
low complexity region 454 462 N/A INTRINSIC
low complexity region 465 481 N/A INTRINSIC
low complexity region 507 519 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127671
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells. The type II keratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This gene encodes a type II keratin that is specifically expressed in the inner root sheath of hair follicles. The type II keratins are clustered in a region of chromosome 12q12-q13. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 A T 14: 78,513,347 S533R probably benign Het
Amph C T 13: 19,104,291 Q317* probably null Het
Bach2 A G 4: 32,562,279 T249A possibly damaging Het
Cacna2d3 A G 14: 28,981,180 C845R probably damaging Het
Calml4 A G 9: 62,871,340 K12E probably benign Het
Chrd C T 16: 20,737,533 R615W probably damaging Het
Chst15 T A 7: 132,269,069 K246* probably null Het
Cmtr2 G A 8: 110,221,603 D182N probably benign Het
Cyp2d9 C A 15: 82,454,324 C186* probably null Het
Cyp3a13 G T 5: 137,911,630 probably null Het
Dcaf17 A T 2: 71,081,988 I320F probably damaging Het
Ddx10 T C 9: 53,233,997 I227V possibly damaging Het
Dlc1 G T 8: 36,938,148 N162K probably benign Het
Dnhd1 G A 7: 105,668,463 R455H probably benign Het
Drg2 G T 11: 60,464,853 A306S probably benign Het
Dsg1a A T 18: 20,332,019 R422S probably damaging Het
Ehbp1l1 A G 19: 5,716,424 V353A probably damaging Het
Emilin2 T C 17: 71,310,761 S34G probably benign Het
Enpp2 C A 15: 54,839,514 W862L probably damaging Het
Exoc2 T C 13: 30,935,502 I139V probably benign Het
Fhad1 C T 4: 141,964,625 R400H probably benign Het
Fv1 C T 4: 147,870,138 T387M probably damaging Het
Gatad1 T A 5: 3,643,701 D156V probably damaging Het
Gm4744 A G 6: 40,950,433 probably benign Het
Gm4799 G A 10: 82,954,635 noncoding transcript Het
Hadha A G 5: 30,128,806 F405S probably benign Het
Ifit3 T C 19: 34,588,251 V399A probably benign Het
Il1rapl1 G T X: 87,304,863 Y150* probably null Het
Kirrel T C 3: 87,090,472 E248G probably benign Het
Loxhd1 G A 18: 77,356,832 G309D probably damaging Het
Mc3r T G 2: 172,249,380 I174S probably benign Het
Me3 A G 7: 89,633,065 D52G probably benign Het
Med12l T C 3: 59,260,835 probably null Het
Mgat5 G A 1: 127,397,641 probably null Het
Mgea5 T C 19: 45,778,640 D99G probably null Het
Mphosph10 A T 7: 64,389,504 F239L probably damaging Het
Mrps7 T C 11: 115,604,197 S13P probably benign Het
Nexn T C 3: 152,237,686 T527A possibly damaging Het
Nlrp1b G A 11: 71,156,059 H1156Y probably damaging Het
Nostrin A G 2: 69,158,785 E120G probably damaging Het
Nsun2 A G 13: 69,631,587 E624G probably damaging Het
Olfr1189 G A 2: 88,592,148 V115I possibly damaging Het
Olfr495 A C 7: 108,396,082 K321Q probably benign Het
Olfr503 G A 7: 108,544,575 V15I probably benign Het
Olfr730 A G 14: 50,187,082 I45T probably damaging Het
Phldb2 T C 16: 45,777,783 N802S probably damaging Het
Pik3c2g T C 6: 139,844,070 probably null Het
Pikfyve T A 1: 65,265,284 I1670N possibly damaging Het
Pld5 A G 1: 175,975,521 F393L probably benign Het
Plekhg1 C A 10: 3,957,361 D759E probably benign Het
Plekhm1 A G 11: 103,387,062 S403P probably benign Het
Pop1 T C 15: 34,510,357 F432L probably benign Het
Ptpn13 T C 5: 103,516,364 I406T probably benign Het
Ptpn5 G T 7: 47,089,875 D185E probably benign Het
Rad50 G T 11: 53,688,151 Q527K possibly damaging Het
Scn7a A G 2: 66,700,163 F613L probably benign Het
Sec16a T A 2: 26,440,045 M653L probably benign Het
Sh3bp2 T C 5: 34,555,576 probably null Het
Slc22a3 G A 17: 12,507,104 T74I probably benign Het
Slc23a4 A G 6: 34,955,122 L272P probably damaging Het
Slc26a8 T C 17: 28,638,562 D869G possibly damaging Het
Slc5a11 T A 7: 123,260,508 V291E probably damaging Het
Slc6a19 C A 13: 73,684,048 A470S probably benign Het
Slfn8 A G 11: 83,003,180 S878P probably damaging Het
Smchd1 A G 17: 71,365,094 M1655T possibly damaging Het
Srgap2 A G 1: 131,292,699 L179P probably damaging Het
Tbx2 A G 11: 85,834,796 D191G probably damaging Het
Tenm3 A G 8: 48,343,316 Y485H probably damaging Het
Trim12c T A 7: 104,340,888 probably benign Het
Trpc6 A G 9: 8,610,169 T213A probably damaging Het
Upp1 T A 11: 9,134,708 probably null Het
Vmn1r46 A T 6: 89,976,216 I16L probably benign Het
Vmn2r75 A T 7: 86,165,642 D214E possibly damaging Het
Vmn2r95 T A 17: 18,439,856 Y177N probably damaging Het
Vmn2r99 T G 17: 19,362,259 I42S possibly damaging Het
Zeb1 A T 18: 5,761,399 K232N possibly damaging Het
Zfp280b T C 10: 76,039,769 I494T probably damaging Het
Zfp804a A G 2: 82,235,799 D38G probably damaging Het
Other mutations in Krt72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Krt72 APN 15 101784999 missense probably damaging 0.99
IGL00568:Krt72 APN 15 101781015 missense probably damaging 1.00
IGL00966:Krt72 APN 15 101780961 missense probably damaging 1.00
IGL01997:Krt72 APN 15 101784880 missense probably damaging 0.99
IGL02858:Krt72 APN 15 101782121 missense probably damaging 1.00
IGL03260:Krt72 APN 15 101778273 missense probably damaging 1.00
R0062:Krt72 UTSW 15 101786008 missense probably damaging 0.98
R0062:Krt72 UTSW 15 101786008 missense probably damaging 0.98
R0601:Krt72 UTSW 15 101786056 missense probably damaging 1.00
R0669:Krt72 UTSW 15 101778305 missense probably damaging 0.99
R1396:Krt72 UTSW 15 101786005 critical splice donor site probably null
R1598:Krt72 UTSW 15 101780253 missense probably benign 0.00
R1779:Krt72 UTSW 15 101780929 missense probably benign
R1796:Krt72 UTSW 15 101781552 splice site probably null
R4259:Krt72 UTSW 15 101778257 missense probably damaging 0.99
R4835:Krt72 UTSW 15 101781073 splice site probably null
R4871:Krt72 UTSW 15 101786034 missense probably damaging 1.00
R6246:Krt72 UTSW 15 101780937 missense probably damaging 1.00
R6513:Krt72 UTSW 15 101776752 critical splice acceptor site probably null
R6520:Krt72 UTSW 15 101781046 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAGCCAAACTGTCTTCCACCTTCC -3'
(R):5'- CAGTTCTGTCCAACCTGGACCATC -3'

Sequencing Primer
(F):5'- TTCCTGTTAAAGCAAACACCG -3'
(R):5'- TGGACCATCCAGTAGATCCTG -3'
Posted On2014-04-13